207 resultados para test sequence

em Scielo Saúde Pública - SP


Relevância:

70.00% 70.00%

Publicador:

Resumo:

The present study evaluated the correlation between the behavior of mice in the forced swimming test (FST) and in the elevated plus-maze (PM). The effect of the order of the experiments, i.e., the influence of the first test (FST or PM) on mouse behavior in the second test (PM or FST, respectively) was compared to handled animals (HAND). The execution of FST one week before the plus-maze (FST-PM, N = 10), in comparison to mice that were only handled (HAND-PM, N = 10) in week 1, decreased % open entries (HAND-PM: 33.6 ± 2.9; FST-PM: 20.0 ± 3.9; mean ± SEM; P<0.02) and % open time (HAND-PM: 18.9 ± 3.3; FST-PM: 9.0 ± 1.9; P<0.03), suggesting an anxiogenic effect. No significant effect was seen in the number of closed arm entries (FST-PM: 9.5 (7.0-11.0); HAND-PM: 10.0 (4.0-14.5), median (interquartile range); U = 46.5; P>0.10). A prior test in the plus-maze (PM-FST) did not change % immobility time in the FST when compared to the HAND-FST group (HAND-FST: 57.7 ± 3.9; PM-FST: 65.7 ± 3.2; mean ± SEM; P>0.10). Since these data suggest that there is an order effect, the correlation was evaluated separately with each test sequence: FST-PM (N = 20) and PM-FST (N = 18). There was no significant correlation between % immobility time in the FST and plus-maze indexes (% time and entries in open arms) in any test sequence (r: -0.07 to 0.18). These data suggest that mouse behavior in the elevated plus-maze is not related to behavior in the forced swimming test and that a forced swimming test before the plus-maze has an anxiogenic effect even after a one-week interval.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mycobacterium tuberculosis strains resistant to streptomycin (SM), isoniazid (INH), and/or rifampin (RIF) as determined by the conventional Löwenstein-Jensen proportion method (LJPM) were compared with the E test, a minimum inhibitory concentration susceptibility method. Discrepant isolates were further evaluated by BACTEC and by DNA sequence analyses for mutations in genes most often associated with resistance to these drugs (rpsL, katG, inhA, and rpoB). Preliminary discordant E test results were seen in 75% of isolates resistant to SM and in 11% to INH. Discordance improved for these two drugs (63%) for SM and none for INH when isolates were re-tested but worsened for RIF (30%). Despite good agreement between phenotypic results and sequencing analyses, wild type profiles were detected on resistant strains mainly for SM and INH. It should be aware that susceptible isolates according to molecular methods might contain other mechanisms of resistance. Although reproducibility of the LJPM susceptibility method has been established, variable E test results for some M. tuberculosis isolates poses questions regarding its reproducibility particularly the impact of E test performance which may vary among laboratories despite adherence to recommended protocols. Further studies must be done to enlarge the evaluated samples and looked possible mutations outside of the hot spot sequenced gene among discrepant strains.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two Brazilian Potato virus Y (PVY) isolates were biologically characterized as necrotic (PVY-NBR) and common (PVY-OBR) based upon symptoms on test plants. Additional characterization was performed by sequencing a cDNA corresponding to the 3' terminal region of the viral genome. The sequence consisted of 195 nucleotides (nt) coding part of the nuclear inclusion body b (NIb) gene, 804 nt of the coat protein (CP) gene, and 328 nt (PVY-OBR) or 326 nt (PVY-NBR) of the 3'-untranslated region (UTR). Translation of the sequence resulted in one single open reading frame with part of the NIb and a CP of 267 amino acids. The two isolates shared 95.1% similarity in the CP amino acid sequence. The CP and the 3'-UTR sequence of the Brazilian isolates were compared to those of other PVY isolates previously reported and unrooted phylogenetic trees were constructed. The trees revealed a separation of two distinct clusters, one comprising most of the common strains and the other comprising the necrotic strains. PVY-OBR was clustered in the common group and PVY-NBR in the necrotic one.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A qualitative spot-test and tandem quantitative analysis of dipyrone in the bulk drug and in pharmaceutical preparations is proposed. The formation of a reddish-violet color indicates a positive result. In sequence a quantitative procedure can be performed in the same flask. The quantitative results obtained were statistically compared with those obtained with the method indicated by the Brazilian Pharmacopoeia, using the Student's t and the F tests. Considering the concentration in a 100 µL aliquot, the qualitative visual limit of detection is about 5×10-6 g; instrumental LOD ≅ 1.4×10-4 mol L-1 ; LOQ ≅ 4.5×10-4 mol L-1.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The measure "mu", proposed as an index of the ability to coordinate concurrent box-crossing (BC) and digit-span (DS) tasks in the dual task (DT), should reflect the capacity of the executive component of the working memory system. We investigated the effect of practice in BC and of a change in the digit span on mu by adding previous practice trials in BC and diminishing, maintaining or increasing the digit sequence length. The mu behavior was evaluated throughout three trials of the test. Reported strategies in digit tasks were also analyzed. Subjects with diminished span showed the best performance in DT due to a stable performance in DS and BC in the single- and dual-task conditions. These subjects also showed a more stable performance throughout trials. Subjects with diminished span tended to employ effortless strategies, whereas subjects with increased span employed effort-requiring strategies and showed the lowest means of mu. Subjects with initial practice trials showed the best performance in BC and the most differentiated performance between the single- and dual-task conditions in BC. The correlation coefficient between the mu values obtained in the first and second trials was 0.814 for subjects with diminished span and practice trials in BC. It seems that the within-session practice in BC and the performance variability in DS affect the reliability of the index mu. To control these factors we propose the introduction of previous practice trials in BC and a modification of the current method to determine the digit sequence length. This proposal should contribute to the development of a more reliable method to evaluate the executive capacity of coordination in the dual-task paradigm.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The influence of aging on memory has been extensively studied, but the importance of short-term memory and recall sequence has not. The objective of the current study was to examine the recall order of words presented on lists and to determine if age affects recall sequence. Physically and psychologically healthy male subjects were divided into two groups according to age, i.e., 23 young subjects (20 to 30 years) and 50 elderly subjects (60 to 70 years) submitted to the Wechsler Adult Intelligence Scale-Revised and the free word recall test. The order of word presentation significantly affected the 3rd and 4th words recalled (P < 0.01; F = 14.6). In addition, there was interaction between the presentation order and the type of list presented (P < 0.05; F = 9.7). Also, both groups recalled the last words presented from each list (words 13-15) significantly more times 3rd and 4th than words presented in all remaining positions (P < 0.01). The order of word presentation also significantly affected the 5th and 6th words recalled (P = 0.05; F = 7.5) and there was a significant interaction between the order of presentation and the type of list presented (P < 0.01; F = 20.8). The more developed the cognitive functions, resulting mainly from formal education, the greater the cognitive reserve, helping to minimize the effects of aging on the long-term memory (episodic declarative).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foi aplicada uma versão reduzida do "Face-Hand Test", o FHT-R, em 91 pessoas com 65 anos ou mais em uma amostra ao acaso de idosos vivendo na comunidade (São Paulo, Brasil), com objetivo de testar a habilidade do instrumento em detectar as síndromes psicorgânicas. Os escores do FHT-R foram comparados com as avaliações de um psiquiatra utilizando uma entrevista semi-estruturada, a "Clinical Interview Schedule". Cinco pessoas foram consideradas como sendo portadoras de distúrbios psicorgânicos e 86 como não sendo portadoras de tais distúrbios. No ponto de corte 0/1 os coeficientes de validação obtidos foram: sensibilidade 60%, especificidade 94%, valor prognóstico positivo 38%, valor prognóstico negativo 98%, e taxa de classificação incorreta 8%. A utilização do Teste em pesquisas epidemiológicas é discutida no corpo do trabalho.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The study was carried out to evaluate the diagnostic performance of the ICT malaria Pf/PvTM test for vivax malaria diagnosis in Belém, Amazon region, Brazil. The results of blood malaria parasites examination using an immunochromatography test were compared with thick blood film (TBF) examination. It was also evaluated the performance of this test storaged at three different temperatures (25°C, 30°C, and 37°C) for 24 hours before use. Overall sensitivity of ICT Pf/PvTM was 61.8% with a specificity of 100%, positive and negative predictive value of 100% and 71.8%, respectively and accuracy of 80.6%. The test sensitivity was independent of the parasite density. This test needs to be further reviewed in order to have better performance for P. vivax malaria diagnosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To analyze the scoring obtained by an instrument, which evaluates the ability to read and understand items in the health care setting, according to education and age. METHODS: The short version of the Test of Functional Health Literacy in Adults was administered to 312 healthy participants of different ages and years of schooling. The study was conducted between 2006 and 2007, in the city of São Paulo, Southeastern Brazil. The test includes actual materials such as pill bottles and appointment slips and measures reading comprehension, assessing the ability to read and correctly pronounce a list of words and understand both prose passages and numerical information. Pearson partial correlations and a multiple regression model were used to verify the association between its scores and education and age. RESULTS: The mean age of the sample was 47.3 years(sd=16.8) and the mean education was 9.7 years(sd=5; range: 1 - 17). A total of 32.4% of the sample showed literacy/numeracy deficits, scoring in the inadequate and marginal functional health literacy ranges. Among the elderly (65 years or older) this rate increased to 51.6%. There was a positive correlation between schooling and scores (r=0.74; p<0.01) and a negative correlation between age and the scores (r=-0.259; p<0.01). The correlation between the scores and age was not significant when the effects of education were held constant (rp=-0.031, p=0.584). A significant association (B=3.877, Beta =0.733; p<0.001) was found between schooling and scores. Age was not a significant predictor in this model (B=-0.035, Beta=-0.22; p=0.584). CONCLUSIONS: The short version of the Test of Functional Health Literacy in Adults was a suitable tool to assess health literacy in the study population. The high number of individuals classified as functional illiterates in this test highlights the importance of special assistance to help them properly understand directions for healthcare.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To assess individual and/or health service factors associated with patients returning for results of HIV or sexually transmitted infection (STI) tests in mental health centers. METHODS: Cross-sectional national multicenter study among 2,080 patients randomly selected from 26 Brazilian mental health centers in 2007. Multilevel logistic regression was used to assess the effect of individual (level 1) and mental health service characteristics (level 2) on receipt of test results. RESULTS: The rate of returning HIV/STI test results was 79.6%. Among health service characteristics examined, only condom distribution was associated with receiving HIV/STI test results, whereas several individual characteristics were independently associated including living in the same city where treatment centers are; being single; not having heard of AIDS; and not having been previously HIV tested. CONCLUSIONS: It is urgent to expand HIV/STI testing in health services which provide care for patients with potentially increased vulnerability to these conditions, and to promote better integration between mental health and health services.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

ABSTRACT OBJECTIVE To validate a Spanish version of the Test of Gross Motor Development (TGMD-2) for the Chilean population. METHODS Descriptive, transversal, non-experimental validity and reliability study. Four translators, three experts and 92 Chilean children, from five to 10 years, students from a primary school in Santiago, Chile, have participated. The Committee of Experts has carried out translation, back-translation and revision processes to determine the translinguistic equivalence and content validity of the test, using the content validity index in 2013. In addition, a pilot implementation was achieved to determine test reliability in Spanish, by using the intraclass correlation coefficient and Bland-Altman method. We evaluated whether the results presented significant differences by replacing the bat with a racket, using T-test. RESULTS We obtained a content validity index higher than 0.80 for language clarity and relevance of the TGMD-2 for children. There were significant differences in the object control subtest when comparing the results with bat and racket. The intraclass correlation coefficient for reliability inter-rater, intra-rater and test-retest reliability was greater than 0.80 in all cases. CONCLUSIONS The TGMD-2 has appropriate content validity to be applied in the Chilean population. The reliability of this test is within the appropriate parameters and its use could be recommended in this population after the establishment of normative data, setting a further precedent for the validation in other Latin American countries.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Twenty patients with prolonged septicemic salmonellosis (Group 1) and 20 with schistosomiasis mansoni (Group 2) were selected for this study. In both groups, the Widal test was done using antigens of the sample Ty 901 (S. typhi). The test was also applied in 6 group 1 patients with antigens prepared from salmonellae isolated from these patients (autoantigens). Titres over 1:200 were considered significant. Ten group 1 patients (50%) were positive for antigen "H" and 5 (25%) were positive for antigen "O". Three patients with negative "H" and "O" reactions became positive with high titres when using autoantigens. Two other cases maintained the same positive titres and one case showed a fourfold increase in titres when the test was done 'with antigens of the Salmonella isolated. The Widal test was positive in most patients infected with group D Salmonellae. Considering titres above 1:200, all cases were negative in Group 2. The authors conclude that the Widal test has low positivity in prolonged septicemic salmonellosis. The test may be valuable in the diagnosis of this disease when using S. paratyphi "A" and "B" antigens and a mixture of Salmonella antigens taken from other groups.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lectins were labeled with fluorescein and tried as conjugates in the immunofluorescence (IP) test for the detection of IgM antibodies to T. gondii, in the diagnosis of acute toxoplasmosis. This approach was an attempt to find alternative reagents for anti-human IgM fluorescent conjugates (AHIgMFC), which contain quite frequently anaibcdies to toxoplasma, as contaminants, due to natural T. gondii infections among animals used for imunization. Lentil (Lens culinaris) lectin fluorescence conjugates (LcFC) provided most satisfactory results. The evaluation of LcFC carried out in a total of 179 sera from patients with acute and chronic toxoplasmosis, with non-related infections or healthy subjects, gave high values of relative efficiency, co-positivity and co-negativity indices, respectively 0.989, 0.969 and 1.000, in reference to the conventional AHIgMFC. Moreover, three batches of LcFC successively prepared gave reproducible test results. The advantage of LcFC as an alternative reagent for the serodiagnosis of acute toxoplasmosis is supported by practical aspects of its preparation.