76 resultados para progeny testing

em Scielo Saúde Pública - SP


Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Liberal-Institutionalism and Structural Realism expectations about international organizations are confronted by looking at if and how US-controlled international aid is granted, and particularly if it is related or not to political affinity and to United Nations Security Council (UNSC) non-permanent membership. A preliminary assessment suggests that these relations only hold for the period of the Cold War, and, even then, only when UNSC non-permanent membership is in years in which the Security Council was deemed very important.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Voluntary HIV counseling and testing are provided to all Brazilian pregnant women with the purpose of reducing mother-to-child HIV transmission. The purpose of the study was to assess characteristics of HIV testing and identify factors associated with HIV counseling and testing. METHODS: A cross-sectional study was carried out comprising 1,658 mothers living in Porto Alegre, Brazil. Biological, reproductive and social variables were obtained from mothers by means of a standardized questionnaire. Being counseling about HIV testing was the dependent variable. Confidence intervals, chi-square test and hierarchical logistic model were used to determine the association between counseling and maternal variables. RESULTS: Of 1,658 mothers interviewed, 1,603 or 96.7% (95% CI: 95.7-97.5) underwent HIV testing, and 51 or 3.1% (95% CI: 2.3-4.0) were not tested. Four (0.2%) refused to undergo testing after counseling. Of 51 women not tested in this study, 30 had undergone the testing previously. Of 1,603 women tested, 630 or 39.3% (95% CI: 36.9-41.7) received counseling, 947 or 59.2% (95% CI: 56.6-61.5) did not, and 26 (1.6%) did not inform. Low income, lack of prenatal care, late beginning of prenatal care, use of rapid testing, and receiving prenatal in the public sector were variables independently associated with a lower probability of getting counseling about HIV testing. CONCLUSIONS: The study findings confirmed the high rate of prenatal HIV testing in Porto Alegre. However, women coming from less privileged social groups were less likely to receive information and benefit from counseling.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To assess HIV testing rate and determine risk factors for not have been tested during pregnancy. METHODS: A cross-sectional study was carried out in Porto Alegre, Southern Brazil, from December 2000 to February 2001. Socioeconomic, maternal and healthcare variables were obtained by means of a standardized questionnaire. Crude and adjusted odds ratios and their 95% confidence intervals were obtained in logistic regression models. RESULTS: A total of 1,642 mothers were interviewed. Of them, 94.3% reported being offered HIV testing before or during pregnancy or during labor; 89 mothers (5.4%) were not tested or did not know if they were tested. Attending fewer than six prenatal visits, being single and younger than 18 years old were relevant barriers preventing HIV testing. There was found a relationship between maternal schooling and the category of prenatal care provider. Having low 22.20 (12.43-39.67) or high 3.38 (1.86-7.68). schooling and being cared in the private sector strongly reduced the likelihood of being HIV tested. CONCLUSIONS: The Brazilian Health Ministry's recommendation for universal counseling and HIV testing has been successfully implemented in the public sector. In order to improve HIV testing coverage, new strategies need to target women cared in the private sector especially those of low schooling.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To assess rates of offering and uptake of HIV testing and their predictors among women who attended prenatal care. METHODS: A population-based cross-sectional study was conducted among postpartum women (N=2,234) who attended at least one prenatal care visit in 12 cities. Independent and probabilistic samples were selected in the cities studied. Sociodemographic data, information about prenatal care and access to HIV prevention interventions during the current pregnancy were collected. Bivariate and multivariate analyses were carried out to assess independent effects of the covariates on offering and uptake of HIV testing. Data collection took place between November 1999 and April 2000. RESULTS: Overall, 77.5% of the women reported undergoing HIV testing during the current pregnancy. Offering of HIV testing was positively associated with: previous knowledge about prevention of mother-to-child transmission of HIV; higher number of prenatal care visits; higher level of education and being white. HIV testing acceptance rate was 92.5%. CONCLUSIONS: The study results indicate that dissemination of information about prevention of mother-to-child transmission among women may contribute to increasing HIV testing coverage during pregnancy. Non-white women with lower level of education should be prioritized. Strategies to increase attendance of vulnerable women to prenatal care and to raise awareness among health care workers are of utmost importance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To assess the feasibility of HIV rapid testing for pregnant women at maternity hospital admission and of subsequent interventions to reduce perinatal HIV transmission. METHODS: Study based on a convenience sample of women unaware of their HIV serostatus when they were admitted to delivery in public maternity hospitals in Rio de Janeiro and Porto Alegre, Brazil, between March 2000 and April 2002. Women were counseled and tested using the Determine HIV1/2 Rapid Test. HIV infection was confirmed using the Brazilian algorithm for HIV infection diagnosis. In utero transmission of HIV was determined using HIV-DNA-PCR. There were performed descriptive analyses of sociodemographic data, number of previous pregnancies and abortions, number of prenatal care visits, timing of HIV testing, HIV rapid test result, neonatal and mother-to-child transmission interventions, by city studied. RESULTS: HIV prevalence in women was 6.5% (N=1,439) in Porto Alegre and 1.3% (N=3.778) in Rio de Janeiro. In Porto Alegre most of women were tested during labor (88.7%), while in Rio de Janeiro most were tested in the postpartum (67.5%). One hundred and forty-four infants were born to 143 HIV-infected women. All newborns but one in each city received at least prophylaxis with oral zidovudine. It was possible to completely avoid newborn exposure to breast milk in 96.8% and 51.1% of the cases in Porto Alegre and Rio de Janeiro, respectively. Injectable intravenous zidovudine was administered during labor to 68.8% and 27.7% newborns in Porto Alegre and Rio de Janeiro, respectively. Among those from whom blood samples were collected within 48 hours of birth, in utero transmission of HIV was confirmed in 4 cases in Rio de Janeiro (4/47) and 6 cases in Porto Alegre (6/79). CONCLUSIONS: The strategy proved feasible in maternity hospitals in Rio de Janeiro and Porto Alegre. Efforts must be taken to maximize HIV testing during labor. There is a need of strong social support to provide this population access to health care services after hospital discharge.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE Determine the coverage rate of syphilis testing during prenatal care and the prevalence of syphilis in pregnant women in Brazil. METHODS This is a national hospital-based cohort study conducted in Brazil with 23,894 postpartum women between 2011 and 2012. Data were obtained using interviews with postpartum women, hospital records, and prenatal care cards. All postpartum women with a reactive serological test result recorded in the prenatal care card or syphilis diagnosis during hospitalization for childbirth were considered cases of syphilis in pregnancy. The Chi-square test was used for determining the disease prevalence and testing coverage rate by region of residence, self-reported skin color, maternal age, and type of prenatal and child delivery care units. RESULTS Prenatal care covered 98.7% postpartum women. Syphilis testing coverage rate was 89.1% (one test) and 41.2% (two tests), and syphilis prevalence in pregnancy was 1.02% (95%CI 0.84;1.25). A lower prenatal coverage rate was observed among women in the North region, indigenous women, those with less education, and those who received prenatal care in public health care units. A lower testing coverage rate was observed among residents in the North, Northeast, and Midwest regions, among younger and non-white skin-color women, among those with lower education, and those who received prenatal care in public health care units. An increased prevalence of syphilis was observed among women with < 8 years of education (1.74%), who self-reported as black (1.8%) or mixed (1.2%), those who did not receive prenatal care (2.5%), and those attending public (1.37%) or mixed (0.93%) health care units. CONCLUSIONS The estimated prevalence of syphilis in pregnancy was similar to that reported in the last sentinel surveillance study conducted in 2006. There was an improvement in prenatal care and testing coverage rate, and the goals suggested by the World Health Organization were achieved in two regions. Regional and social inequalities in access to health care units, coupled with other gaps in health assistance, have led to the persistence of congenital syphilis as a major public health problem in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE To analyze the clinical and laboratory characteristics of HIV-infected individuals upon admission to a reference health care center.METHODS This cross-sectional study was conducted between 1999 and 2010 on 527 individuals with confirmed serological diagnosis of HIV infection who were enrolled in an outpatient health care service in Santarém, PA, Northern Brazil. Data were collected from medical records and included the reason for HIV testing, clinical status, and count of peripheral CD4+ T lymphocytes upon enrollment. The data were divided into three groups, according to the patient’s year of admission – P1 (1999-2002), P2 (2003-2006), and P3 (2007-2010) – for comparative analysis of the variables of interest.RESULTS In the study group, 62.0% of the patients were assigned to the P3 group. The reason for undergoing HIV testing differed between genders. In the male population, most tests were conducted because of the presence of symptoms suggesting infection. Among women, tests were the result of knowledge of the partner’s seropositive status in groups P1 and P2. Higher proportion of women undergoing testing because of symptoms of HIV/AIDS infection abolished the difference between genders in the most recent period. A higher percentage of patients enrolling at a more advanced stage of the disease was observed in P3.CONCLUSIONS Despite the increased awareness of the number of HIV/AIDS cases, these patients have identified their serological status late and were admitted to health care units with active disease. The HIV/AIDS epidemic in Pará presents specificities in its progression that indicate the complex characteristics of the epidemic in the Northern region of Brazil and across the country.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Brazilian National Regulatory Agency for Private Health Insurance and Plans has recently published a technical note defining the criteria for the coverage of genetic testing to diagnose hereditary cancer. In this study we show the case of a patient with a breast lesion and an extensive history of cancer referred to a private service of genetic counseling. The patient met both criteria for hereditary breast and colorectal cancer syndrome screening. Her private insurance denied coverage for genetic testing because she lacks current or previous cancer diagnosis. After she appealed by lawsuit, the court was favorable and the test was performed using next-generation sequencing. A deletion of MLH1 exon 8 was found. We highlight the importance to offer genetic testing using multigene analysis for noncancer patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The susceptibility of the MAP Brazilian strain (F1 to F5 progenies) of S. mansoni to four antischistosomal drugs has been reported in a previous study. In the present investigation, progeny F14 of the same strain, was tested for stability to the same 4 drugs. A new medication, Oltipraz (35,972 RP), was added to the study. Five groups of 12 mice infected with cercariae by tail immersion were treated with hycanthone, oxamniquine, niridazole, praziquantel and Oltipraz. An untreated group was used as control. Schistosomal activity was assessed by the localization of worms in the portal vein system, by oogram changes, and percentage of parasite reduction. The stability of the susceptibility of progeny F14 did not change in relation to generations F1 to F5; the progeny was resistant to hycanthone and oxamniquine; but sensitive to niridazole, praziquantel and Oltipraz. We emphasize the importance of the phenomenon of resistance of the worm in view of the fact that oxamniquine has been widely used in Brazilian areas where mansonic schistosomiasis is endemic.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A candidin, which is a suspension of killed yeast cells, is commonly used for intradermal tests of delayed hypersensitivity, to evaluate the immunological cellular competence of the patient, when the test is applied along with other similar tests. When working with a cellular antigen, the histopathology of positive skin tests reveals a cellular infiltrate which not only presents a characteristic hypersensitivity reaction but also a neutrophilic abscess in the central part. This research presents the results of a comparison between the yeast cell suspension and the polysaccharide antigens, both obtained from the same strains of Candida albicans. The results obtained by skin tests in one hundred individuals were 61.0% with the polysaccharide antigen and 69.0% with the yeast cell suspension antigen. Concordant results concerning the two antigens were observed in 82.0% of the individuals. The discussion section presents an assumption to explain the differences of positivity obtained with the two antigens. We conclude that the polysaccharide antigen can be utilized in the intradermal test of delayed hypersensitivity to Candida albicans.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Based on the difficulties experienced in the treatment of chromoblastomycosis, 12 primary human isolates of F. pedrosoi, were tested for their in vitro susceptibility to various antimycotics. We adapted the recommendations of the NCCLS for yeasts and followed the indications for mold testing from other authors in order to determine their MIC’s and the MLC’s. It was found that a significant proportion of the isolates were resistant to 3 of the 4 antimycotics tested, as revealed by high MIC values, as follows: 33% were resistant to amphotericin B (AMB), 58.3% to 5 fluocytosine (5 FC) and 66.7% to fluconazole (FLU). Contrarywise, none of the isolates proved resistant to itraconazole (ITZ). Determination of the MLC’s revealed that a larger proportion of the isolates were not killed by AMB, 5 FC (91.7%), FLU (100%) or even, ITZ (41.7%). These data indicate that it would be desirable to determine the susceptibility of F. pedrosoi before initiating therapy, in order to choose the more effective antifungal and avoid clinical failure

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A comparison of the Etest and the reference broth macrodilution susceptibility test for fluconazole, ketoconazole, itraconazole and amphotericin B was performed with 59 of Candida species isolated from the oral cavities of AIDS patients. The Etest method was performed according to the manufacturer's instructions, and the reference method was performed according to National Committee for Clinical Laboratory Standards document M27-A guidelines. Our data showed that there was a good correlation between the MICs obtained by the Etest and broth dilution methods. When only the MIC results at ± 2 dilutions for both methods were considered, the agreement rates were 90.4% for itraconazole, ketoconazole and amphotericin B and 84.6% for fluconazole of the C. albicans tested. In contrast, to the reference method, the Etest method classified as susceptible three fluconazole-resistant isolates and one itraconazole-resistant isolate, representing four very major errors. These results indicate that Etest could be considered useful for antifungal sensitivity evaluation of yeasts in clinical laboratories.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An "in-house" RT-PCR method was developed that allows the simultaneous detection of the RNA of the Hepatitis C Virus (HCV) and an artificial RNA employed as an external control. Samples were analyzed in pools of 6-12 donations, each donation included in two pools, one horizontal and one vertical, permitting the immediate identification of a reactive donation, obviating the need for pool dismembering. The whole process took 6-8 hours per day and results were issued in parallel to serology. The method was shown to detect all six HCV genotypes and a sensitivity of 500 IU/mL was achieved (95% hit rate). Until July 2005, 139,678 donations were tested and 315 (0.23%) were found reactive for HCV-RNA. Except for five false-positives, all 310 presented the corresponding antibody as well, so the yield of NAT-only donations was zero, presenting a specificity of 99.83%. Detection of a window period donation, in the population studied, will probably demand testing of a larger number of donations. International experience is showing a rate of 1:200,000 - 1:500,000 of isolated HCV-RNA reactive donations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The antifungal activities of itraconazole, ketoconazole, fluconazole, terbinafine and griseofulvin were tested by broth microdilution methods against 71 isolates of dermatophytes isolated from Nigerian children. Most drugs were very active against all the dermatophytes and the MIC 90 ranged from 0.03 to 8.0 µg/mL. This appears to be the first documented data on the antifungal susceptibility testing of isolates of dermatophytes from Nigerian children.