128 resultados para immune response gene

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In August 1983 the Authors studied 36 patients with Plasmodium falciparum malaria and 14 normal individuals born in Humaita region who had never had malaria, had no spleen enlargement and had negative parasitemia as well as passive hemagglutination. Medical histories were obtained and complete physical examination were performed in all of them just as blood tests, parasite density and lymphocyte typing. The lymphocytes were separated and then frozen in liquid nitrogen for later typing by rosette formation. The patients were divided in two groups according to the presence (13 patients) or abscence (23 patients) of gametocytes before treatment. Severe malaria was predominant in the group without gametocytes. The results showed a decrease in the T-cell numbers in Plasmodium falciparum acute malaria patients both with or without gametocytes before the treatment, while B-cell numbers were normal only in the patients with gametocytes. These observations as like as those previously reported by the Authors, permit to associate the presence of gametocytes in peripheral blood and normal number of B-cells in patients with mild Plasmodium falciparum malaria.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The occurrence of secondary cell mediated immune response (CMI) in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue) antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The authors developed a comparative study of the various methods of assessment of immune response to Hepatitis B vaccine. Eighty-six health care professionals underwent a vaccination programme with three doses of plasma-derived vaccine against Hepatitis B (H-B-Vax, Merck, Sharp & Dohme) given intra-muscularly. Assessment of immune response was carried out three months after the end of the programme, by radioimmunoassay (RIA) and enzymeimmunoassay (EIA). The results showed that the semi-quantitative assessment of Anti-HBs antibodies by RIA or EIA was perfectly comparable to the reference method (quantitative determination of antibodies by RIA). In view of these findings, the authors suggest a standardization of assessment of immune response to the vaccine, thus permitting correct planning of booster doses and easier comparison between different studies

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The humoral and cellular immune responses as well as the resistance to infection with bloodstream forms of T. cruzi were studied in mice immunized with acidic antigenic fractions from parasite cytosol, F III and F IV, plus Bordetella pertussis as adjuvant. The immunization with F III induced positive ITH and DTH responses to homologous antigens. In mice immunized with F IV, the ITH was negative and four out of six animals presented positive DTH reactions. In both groups of mice the analysis of IgG aginst T. cruzi showed that the major isotype elicited was IgG1. Specific IgE was also detected in sera from F III immunized mice, thus confirming the presence of homocytothropic antibodies. The parasitemias reached by F III and F IV immunized mice after challenge were lower than those of the controls showing in this way a partial protection against the acute infection. The histological studies of heart and skeletal muscle performed two months after the infection revealed variable mononuclear infiltration in all infected mice despite immunization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Leptospirosis severity may be increasing, with pulmonary involvement becoming more frequent. Does this increase result from an intense immune response to leptospire? Notice that renal failure, thrombocytopenia and pulmonary complications are found during the immune phase. Thirty-five hospitalized patients with Weil's disease had 5 blood samples drawn, from the 15th day to the 12th month of symptoms, for ELISA-IgM, -IgG and -IgA specific antibody detection. According their 1st IgG titer, the patients were divided into: group 1 (n = 13) titer > 1:400 (positive) and group 2 (n = 22) titer <=1:400 (negative). Early IgG antibodies in group 1 showed high avidity which may indicate reinfection. Group 1 was older, had worse pulmonary and renal function, and fever for a longer period than group 2. Throughout the study, IgG and IgA titers remained higher in group 1. In conclusion, the severity of Weil's disease may be associated with the intensity of the humoral immune response to leptospire.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The interaction between specific immune response to Schistosoma mansoni and praziquantel (PZQ) was studied in mice. In mice harboring concomitant immunity, 6-day-old parasites treated with PZQ were more effectively removed than 24h treated parasites despite both had a significant worm burden reduction when compared with respective treated controls. These results show that PZQ can be effective at the skin and lung stages of parasite's development mainly acting with a established specific immune response, and particularly at the lung phase.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

SUMMARY The efficacy of nitazoxanide (NTZ) against toxocariasis was investigated in an experimental murine model and results were compared to those obtained using mebendazole. Sixty male BALB/c mice, aged six to eight weeks-old, were divided into groups of 10 each; fifty were orally infected with 300 larvaed eggs of T. canisand grouped as follows, G I: infected untreated mice; G II: infected mice treated with MBZ (15 mg/kg/day) 10 days postinfection (dpi); G III: infected mice treated with NTZ (20 mg/kg/day) 10 dpi; G IV: infected mice treated with MBZ 60 dpi; G V: infected mice treated with NTZ 60 dpi; GVI: control group comprising uninfected mice. Mice were bled via retro-orbital plexus on four occasions between 30 and 120 dpi. Sera were processed using the ELISA technique to detect IgG anti- Toxocaraantibodies. At 120 dpi, mice were sacrificed for larval recovery in the CNS, liver, lungs, kidneys, eyes and carcass. Results showed similar levels of anti- ToxocaraIgG antibodies among mice infected but not submitted to treatment and groups treated with MBZ or NTZ, 10 and 60 dpi. Larval recovery showed similar values in groups treated with NTZ and MBZ 10 dpi. MBZ showed better efficacy 60 dpi, with a 72.6% reduction in the parasite load compared with NTZ, which showed only 46.5% reduction. We conclude that administration of these anthelmintics did not modify the humoral response in experimental infection by T. canis. No parasitological cure was observed with either drug; however, a greater reduction in parasite load was achieved following treatment with MBZ.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Dipetalogaster maximus embryo extracts were used to stimulate peripheral blood mononuclear cells (PBMC) and in ELISA with sera either from Trypanosoma cruzi infected or non-infected individuals. The results showed that there was significant proliferative response and high antibody titers in sera of chagasic patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Philander frenata and Didelphis marsupialis harbor parasitism by Trypanosoma cruzi without developing any apparent disease and on the contrary to D. marsupialis, P. frenata maintains parasitism by T. cruzi II subpopulations. Here we compared the humoral immune response of the two didelphids naturally and experimentally infected with T. cruzi II group, employing SDS-PAGE/Western blot techniques and by an Indirect immunofluorescence assay. We also studied the histopathological pattern of naturally and experimentally infected P. frenata with T. cruzi. P. frenata sera recognized more antigens than D. marsupialis, and the recognition pattern did not show any change over the course of the follow up of both didelphid species. Polypeptides of 66 and 90kDa were the most prominent antigens recognized by both species in the soluble and enriched membrane fractions. P. frenata recognized intensely also a 45kDa antigen. Our findings indicate that: 1) there were no quantitative or qualitative differences in the patent or subpatent phases in the recognition pattern of P. frenata; 2) the significant differences in the recognition pattern of parasitic antigens by P. frenata and D. marsupialis sera suggest that they probably "learned" to live in harmony with T. cruzi by different strategies; 3) although P. frenata do not display apparent disease, tissular lesions tended to be more severe than has been described in D. marsupialis; and 4) Both didelphids probably acquired infection by T. cruzi after their evolutionary divergence.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Humoral and cellular immune responses were evaluated in 44 C57BL/6 mice immunized with the Trypanosoma cruzi recombinant antigens CRA and FRA. Both antigens induced cutaneous immediate-type hypersensitivity response. The levels of IgG1, IgG2a, IgG2b and IgG3 were high in CRA immunized mice. IgG3 was the predominant isotype. Although no difference in antibody levels was observed in FRA-immunized mice when compared to control mice, both antigens were able to induce lymphoproliferation in immunized mice. Significant differences were observed between incorporation of [³H]- thymidine by spleen cell stimulated in vitro with CRA or FRA and the control group. These results suggest that CRA and FRA could be involved in mechanisms of resistance to Trypanosoma cruzi infection.