DETECTION AND QUANTIFICATION OF PHYTOCHEMICAL MARKERS OF Ilex paraguariensis BY LIQUID CHROMATOGRAPHY

Ilex paraguariensis (yerba-mate) is used as a beverage, and its extract requires adequate quality control methods in order to guarantee quality and safe use. Strategies to develop and optimize a chromatographic method to quantify theobromine, caffeine, and chlorogenic acid in I. paraguariensis extracts were evaluated by applying a quality by design (QbD) model and ultra high-performance liquid chromatography (UHPLC). The presence of these three phytochemical markers in the extracts was evaluated using UHPLC-MS and was confirmed by the chromatographic bands in the total ion current traces (m/z of 181.1 [M+H]+, 195.0 [M+H]+, and 353.0 [M−H]−, respectively). The developed method was then transferred to a high-performance liquid chromatography (HPLC) platform, and the three phytochemical markers were used as external standards in the validation of a method for analyses of these compounds in extracts using a diode array detector (DAD). The validated method was applied to quantify the chlorogenic acid, caffeine, and theobromine in the samples. HPLC-DAD chromatographic fingerprinting was also used in a multivariate approach to process the entire data and to separate the I. paraguariensis extracts into two groups. The developed method is very useful for qualifying and quantifying I. paraguariensis extracts.

Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica

Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis.

Identification of Mycobacteria by Thin Layer Chromatographic Analysis of Mycolic Acids and Conventional Biochemical Method: Four Years of Experience

Mycolic acids analysis by thin-layer chromatography (TLC) has been employed by several laboratories worldwide as a method for fast identification of mycobacteria. This method was introduced in Brazil by our laboratory in 1992 as a routine identification technique. Up to the present, 861 strains isolated were identified by mycolic acids TLC and by standard biochemical tests; 61% out of these strains came as clinical samples, 4% isolated from frogs and 35% as environmental samples. Mycobacterium tuberculosis strains identified by classical methods were confirmed by their mycolic acids contents (I, III and IV). The method allowed earlier differentiation of M. avium complex - MAC (mycolic acids I, IV and VI) from M. simiae (acids I, II and IV), both with similar biochemical properties. The method also permitted to distinguish M. fortuitum (acids I and V) from M. chelonae (acids I and II) , and to detect mixed mycobacterial infections cases as M. tuberculosis with MAC and M. fortuitum with MAC. Concluding, four years experience shows that mycolic acids TLC is an easy, reliable, fast and inexpensive method, an important tool to put together conventional mycobacteria identification methods.

IS6110 fingerprinting of sensitive and resistant strains (1991-1992) of Mycobacterium tuberculosis in Colombia

The standardized method to study the polymorphism of IS 6110 was used to characterize 53 isolates of Mycobacterium tuberculosis obtained during 1991-1992 from 14 regions in Colombia. In Valle region cluster rate was 25% (4/16). The mean number of IS6110 band was 10 ± 3. Similarity between strains was of 60% in 81% of strains and this tended to be correlated with geographic origin. For the first time M. tuberculosis without IS6110 bands in restriction fragment length polymorphism analysis was found in Colombia. Additional studies are necessaries in order to best characterize the situation in relation to human immunodeficiency virus epidemic and recent changes in tuberculosis control program.

Genetic relationships between sympatric populations of Bacillus cereus and Bacillus thuringiensis, as revealed by rep-PCR genomic fingerprinting

The bacterial strain Bacillus cereus is closely related to Bacillus thuringiensis, although any genetic relationship between the two strains is still in debate. Using rep-PCR genomic fingerprinting, we established the genetic relationships between Brazilian sympatric populations of B. cereus and B. thuringiensis simultaneously collected from two geographically separate sites. We observed the formation of both B. thuringiensis and B. cereus clusters, as well as strains of B. cereus that are more closely related to B. thuringiensis than to other B. cereus strains. In addition, lower genetic variability was observed among B. thuringiensis clusters compared to B. cereus clusters, indicating that either the two species should be categorized as separate or that B. thuringiensis may represent a clone from a B. cereus background.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Classification and fingerprinting of different berries based on biochemical profiling and antioxidant capacity

The objective of this work was to evaluate the biochemical composition of six berry types belonging to Fragaria, Rubus, Vaccinium and Ribes genus. Fruit samples were collected in triplicate (50 fruit each) from 18 different species or cultivars of the mentioned genera, during three years (2008 to 2010). Content of individual sugars, organic acids, flavonols, and phenolic acids were determined by high performance liquid chromatography (HPLC) analysis, while total phenolics (TPC) and total antioxidant capacity (TAC), by using spectrophotometry. Principal component analysis (PCA) and hierarchical cluster analysis (CA) were performed to evaluate the differences in fruit biochemical profile. The highest contents of bioactive components were found in Ribes nigrum and in Fragaria vesca, Rubus plicatus, and Vaccinium myrtillus. PCA and CA were able to partially discriminate between berries on the basis of their biochemical composition. Individual and total sugars, myricetin, ellagic acid, TPC and TAC showed the highest impact on biochemical composition of the berry fruits. CA separated blackberry, raspberry, and blueberry as isolate groups, while classification of strawberry, black and red currant in a specific group has not occurred. There is a large variability both between and within the different types of berries. Metabolite fingerprinting of the evaluated berries showed unique biochemical profiles and specific combination of bioactive compound contents.

Performance characteristics of bioassay UV-spectrophotometry and high perfomance liquid chromatographic determination of gatifloxacin in tablets

The microbiological bioassay, UV-spectrophotometry and HPLC methods for assaying gatifloxacin in tablets were compared. Validation parameters such as linearity, precision, accuracy, limit of detection and limit of quantitation were determined. Beer's law was obeyed in the ranges 4.0-14.0 μg/mL for HPLC and UV-spectrophotometric method, and 4.0-16.0 μg/mL for bioassay. All methods were reliable within acceptable limits for antibiotic pharmaceutical preparations being accurate, precise and reproducible. The bioassay and HPLC are more specific than UV-spectrophotometric analysis. The application of each method as a routine analysis should be investigated considering cost, simplicity, equipment, solvents, speed, and application to large or small workloads.

Comparison of gas chromatographic and gravimetric methods for quantization of total fat and fatty acids in foodstuffs

Different methods to determine total fat (TF) and fatty acids (FA), including trans fatty acids (TFA), in diverse foodstuffs were evaluated, incorporating gravimetric methods and gas chromatography with flame ionization detector (GC/FID), in accordance with a modified AOAC 996.06 method. Concentrations of TF and FA obtained through these different procedures diverged (p< 0.05) and TFA concentrations varied beyond 20 % of the reference values. The modified AOAC 996.06 method satisfied both accuracy and precision, was fast and employed small amounts of low toxicity solvents. Therefore, the results showed that this methodology is viable to be adopted in Brazil for nutritional labeling purposes.

Development and validation of a high performance liquid chromatographic method for determination of cyclosporine-A from biodegradable intraocular implants

An HPLC method was developed and validated aiming to quantify the cyclosporine-A incorporated into intraocular implants, released from them; and in direct contact with the degradation products of PLGA. The separation was carried out in isocratic mode using acetonitrile/water (70:30) as mobile phase, a C18 column at 80 ºC and UV detection at 210 nm. The method provided selectivity based on resolution among peaks. It was linear over the range of 2.5-40.0 µg/mL. The quantitation and detection limits were 0.8 and 1.2 µg/mL, respectively. The recovery was 101.8% and intra-day and inter-day precision was close to 2%.

Chemical stability of enalapril maleate drug substance and tablets by a stability-indicating liquid chromatographic method

The chemical stability of enalapril drug substance and tablets was studied by a stability-indicating liquid chromatographic method. Stress testing was performed on drug substance under various conditions. Accelerated stability testing was carried out for different formulations of enalapril tablets. Chromatographic separation was achieved on a RP-18 column, using a mobile phase of methanol phosphate buffer at 1.0 mL min"1 and UV detection. Degradation of the drug substance was greater under hydrolytic conditions. After 180 days of accelerated stability testing most enalapril tablets showed more than 10% of degradation. Enalapril drug substance and tablets showed instability under stress and accelerated testing respectively, with possible implications on the therapeutic activity.

Liquid-phase microextraction for simultaneous chromatographic analysis of three antidepressant drugs in plasma

A method using Liquid Phase Microextraction for simultaneous detection of citalopram (CIT), paroxetine (PAR) and fluoxetine (FLU), using venlafaxine as internal standard, in plasma by high performance liquid chromatography with fluorescence detection was developed. The linearity was evaluated between 5.0 and 500 ng mL-1 (r > 0.99) and the limit of quantification was 2.0, 3.0 and 5.0 ng mL-1 for CIT, PAR and FLU, respectively. Therefore, it can be applied to therapeutic drug monitoring, pharmacokinetics or bioavailability studies and its advantages are that it necessary relatively inexpensive equipment and sample preparation techniques.

High performance thin layer chromatographic determination of nifedipine in human serum after liquid-liquid extraction

A method using HPTLC for quantitation of nifedipine in serum was developed and validated. It includes a liquid-liquid extraction, and carbamazepine as internal standard. Chloroform: ethyl acetate: cyclohexane (19:2:2, v/v/v) was the mobile phase. The method showed good relationship (r = 0.996) (2.00 to 25.00 ng/band, corresponding to 0.02 and 0.25 ng/µL in serum). The % RSD of intra-assay and inter-assay, were between 0.57 and 3.56 and 1.16 to 3.60, respectively. LOD and LOQ were 0.72 and 0.86 ng/band, respectively. The recovery values were between 93 and 102%. Rf for nifedipine and carbamazepine were 0.31 and 0.10, respectively.

Evaluation of pesticide adsorption in gas chromatographic injector and column

Components in complex matrices can cause variations in chromatographic response during analysis of pesticides by gas chromatography. These variations are related to the competition between analytes and matrix components for adsorption sites in the chromatographic system. The capacity of the pesticides chlorpyrifos and deltamethrin to be adsorbed in the injector and chromatographic column was evaluated by constructing three isotherms and changing the column heating rate to 10 and 30 ºC min-1. By using ANCOVA to compare the slope of calibration graphs, results showed that the higher the injector temperature (310 ºC) the lower the pesticide adsorption. Also, deltamethrin influenced the adsorption of chlorpyrifos on the column chromatographic.