28 resultados para Human genome

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The mechanisms that determine viral clearance or viral persistence in chronic viral hepatitis have yet to be identified. Recent advances in molecular genetics have permitted the detection of variations in immune response, often associated with polymorphism in the human genome. Differences in host susceptibility to infectious disease and disease severity cannot be attributed solely to the virulence of microbial agents. Several recent advances concerning the influence of human genes in chronic viral hepatitis B and C are discussed in this article: a) the associations between human leukocyte antigen polymorphism and viral hepatic disease susceptibility or resistance; b) protective alleles influencing hepatitis B virus (HBV) and hepatitis C virus (HCV) evolution; c) prejudicial alleles influencing HBV and HCV; d) candidate genes associated with HBV and HCV evolution; d) other genetic factors that may contribute to chronic hepatitis C evolution (genes influencing hepatic stellate cells, TGF-beta1 and TNF-alpha production, hepatic iron deposits and angiotensin II production, among others). Recent discoveries regarding genetic associations with chronic viral hepatitis may provide clues to understanding the development of end-stage complications such as cirrhosis or hepatocellular carcinoma. In the near future, analysis of the human genome will allow the elucidation of both the natural course of viral hepatitis and its response to therapy.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Since the start of the human genome project, a great number of genome projects on other "model" organism have been initiated, some of them already completed. Several initiatives have also been started on parasite genomes, mainly through support from WHO/TDR, involving North-South and South-South collaborations, and great hopes are vested in that these initiatives will lead to new tools for disease control and prevention, as well as to the establishment of genomic research technology in developing countries. The Trypanosoma cruzi genome project, using the clone CL-Brener as starting point, has made considerable progress through the concerted action of more than 20 laboratories, most of them in the South. A brief overview of the current state of the project is given

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The development of biotechnology in the last three decades has generated the feeling that the newest scientific achievements will deliver high standard quality of life through abundance of food and means for successfully combating diseases. Where the new biotechnologies give access to genetic information, there is a common belief that physiological and pathological processes result from subtle modifications of gene expression. Trustfully, modern genetics has produced genetic maps, physical maps and complete nucleotide sequences from 141 viruses, 51 organelles, two eubacteria, one archeon and one eukaryote (Saccharomices cerevisiae). In addition, during the Centennial Commemoration of the Oswaldo Cruz Institute the nearly complete human genome map was proudly announced, whereas the latest Brazilian key stone contribution to science was the publication of the Shillela fastidiosa genomic sequence highlythed on a Nature cover issue. There exists a belief among the populace that further scientific accomplishments will rapidly lead to new drugs and methodological approaches to cure genetic diseases and other incurable ailments. Yet, much evidence has been accumulated, showing that a large information gap exists between the knowledge of genome sequence and our knowledge of genome function. Now that many genome maps are available, people wish to know what are we going to do with them. Certainly, all these scientific accomplishments will shed light on many more secrets of life. Nevertheless, parsimony in the weekly announcements of promising scientific achievements is necessary. We also need many more creative experimental biologists to discover new, as yet un-envisaged biotechnological approaches, and the basic resource needed for carrying out mile stone research necessary for leading us to that "promised land"often proclaimed by the mass media.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

To provide a novel resource for analysis of the genome of Biomphalaria glabrata, members of the international Biomphalaria glabrata Genome Initiative (biology.unm.edu/biomphalaria-genome.html), working with the Arizona Genomics Institute (AGI) and supported by the National Human Genome Research Institute (NHGRI), produced a high quality bacterial artificial chromosome (BAC) library. The BB02 strain B. glabrata, a field isolate (Belo Horizonte, Minas Gerais, Brasil) that is susceptible to several strains of Schistosoma mansoni, was selfed for two generations to reduce haplotype diversity in the offspring. High molecular weight DNA was isolated from ovotestes of 40 snails, partially digested with HindIII, and ligated into pAGIBAC1 vector. The resulting B. glabrata BAC library (BG_BBa) consists of 61824 clones (136.3 kb average insert size) and provides 9.05 × coverage of the 931 Mb genome. Probing with single/low copy number genes from B. glabrata and fingerprinting of selected BAC clones indicated that the BAC library sufficiently represents the gene complement. BAC end sequence data (514 reads, 299860 nt) indicated that the genome of B. glabrata contains ~ 63% AT, and disclosed several novel genes, transposable elements, and groups of high frequency sequence elements. This BG_BBa BAC library, available from AGI at cost to the research community, gains in relevance because BB02 strain B. glabrata is targeted whole genome sequencing by NHGRI.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

We have developed a software called pp-Blast that uses the publicly available Blast package and PVM (parallel virtual machine) to partition a multi-sequence query across a set of nodes with replicated or shared databases. Benchmark tests show that pp-Blast running in a cluster of 14 PCs outperformed conventional Blast running in large servers. In addition, using pp-Blast and the cluster we were able to map all human cDNAs onto the draft of the human genome in less than 6 days. We propose here that the cost/benefit ratio of pp-Blast makes it appropriate for large-scale sequence analysis. The source code and configuration files for pp-Blast are available at http://www.ludwig.org.br/biocomp/tools/pp-blast.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Major histocompatibility complex class I chain-related A (MICA) is a highly polymorphic gene located within the MHC class I region of the human genome. Expressed as a cell surface glycoprotein, MICA modulates immune surveillance by binding to its cognate receptor on natural killer cells, NKG2D, and its genetic polymorphisms have been recently associated with susceptibility to some infectious diseases. We determined whether MICA polymorphisms were associated with the high rate of Schistosoma parasitic worm infection or severity of disease outcome in the Dongting Lake region of Hunan Province, China. Polymerase chain reaction-sequence specific priming (PCR-SSP) and sequencing-based typing (SBT) were applied for high-resolution allele typing of schistosomiasis cases (N = 103, age range = 36.2-80.5 years, 64 males and 39 females) and healthy controls (N = 141, age range = 28.6-73.3 years, 73 males and 68 females). Fourteen MICA alleles and five short-tandem repeat (STR) alleles were identified among the two populations. Three (MICA*012:01/02, MICA*017 and MICA*027) showed a higher frequency in healthy controls than in schistosomiasis patients, but the difference was not significantly correlated with susceptibility to S. japonicum infection (Pc > 0.05). In contrast, higher MICA*A5 allele frequency was significantly correlated with advanced liver fibrosis (Pc < 0.05). Furthermore, the distribution profile of MICA alleles in this Hunan Han population was significantly different from those published for Korean, Thai, American-Caucasian, and Afro-American populations (P < 0.01), but similar to other Han populations within China (P > 0.05). This study provides the initial evidence that MICA genetic polymorphisms may underlie the severity of liver fibrosis occurring in schistosomiasis patients from the Dongting Lake region.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

INTRODUCTION: Human cytomegalovirus is an opportunistic betaherpesvirus that causes persistent and serious infections in immunodeficient patients. Recurrent infections occur due to the presence of the virus in a latent state in some cell types. It is possible to examine the virus using molecular methods to aid in the immunological diagnosis and to generate a molecular viral profile in immunodeficient patients. The objective of this study was to characterize cytomegalovirus genotypes and to generate the epidemiological and molecular viral profile in immunodeficient patients. METHODS: A total of 105 samples were collected from immunodeficient patients from the City of Belém, including newborns, hemodialysis patients, transplant recipients and HIV+ patients. An IgG and IgM antibody study was completed using ELISA, and enzymatic analysis by restriction fragment length polymorphism (RFLP) was performed to characterize viral genotypes. RESULTS: It was observed that 100% of the patients had IgG antibodies, 87% of which were IgG+/IgM-, consistent with a prior infection profile, 13% were IgG+/IgM+, suggestive of recent infection. The newborn group had the highest frequency (27%) of the IgG+/IgM+ profile. By RFLP analysis, only one genotype was observed, gB2, which corresponded to the standard AD169 strain. CONCLUSIONS: The presence of IgM antibodies in new borns indicates that HCMV continues to be an important cause of congenital infection. The low observed genotypic diversity could be attributed to the small sample size because newborns were excluded from the RFLP analysis. This study will be continued including samples from newborns to extend the knowledge of the general and molecular epidemiology of HCMV in immunodeficient patients.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Schistosomes have a comparatively large genome, estimated for Schistosoma mansoni to be about 270 megabase pairs (haploid genome). Recent findings have shown that mobile genetic elements constitute significant proportions of the genomes of S. mansoni and S. japonicum. Much less information is available on the genome of the third major human schistosome, S. haematobium. In order to investigate the possible evolutionary origins of the S. mansoni long terminal repeat retrotransposons Boudicca and Sinbad, several genomes were searched by Southern blot for the presence of these retrotransposons. These included three species of schistosomes, S. mansoni, S. japonicum, and S. haematobium, and three related platyhelminth genomes, the liver flukes Fasciola hepatica and Fascioloides magna and the planarian, Dugesia dorotocephala. In addition, Homo sapiens and three snail host genomes, Biomphalaria glabrata, Oncomelania hupensis, and Bulinus truncatus, were examined for possible indications of a horizontal origin for these retrotransposons. Southern hybridization analysis indicated that both Boudicca and Sinbad were present in the genome of S. haematobium. Furthermore, low stringency Southern hybridization analyses suggested that a Boudicca-like retrotransposon was present in the genome of B. truncatus, the snail host of S. haematobium.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Several human genetic syndromes have long been recognized to be defective in DNA repair mechanisms. This was first discovered by Cleaver (1968), who showed that cells from patients with xeroderma pigmentosum (XP) were defective for the ability to remove ultraviolet (UV)-induced lesions from their genome. Since then, new discoveries have promoted DNA repair studies to one of the most exciting areas of molecular biology. The present work intends to give a brief summary of the main known human genetic diseases related to DNA repair and how they may be linked to acquired diseases such as cancer

Relevância:

40.00% 40.00%

Publicador:

Resumo:

DNA methylation is essential in X chromosome inactivation and genomic imprinting, maintaining repression of XIST in the active X chromosome and monoallelic repression of imprinted genes. Disruption of the DNA methyltransferase genes DNMT1 and DNMT3B in the HCT116 cell line (DKO cells) leads to global DNA hypomethylation and biallelic expression of the imprinted gene IGF2 but does not lead to reactivation of XIST expression, suggesting thatXIST repression is due to a more stable epigenetic mark than imprinting. To test this hypothesis, we induced acute hypomethylation in HCT116 cells by 5-aza-2′-deoxycytidine (5-aza-CdR) treatment (HCT116-5-aza-CdR) and compared that to DKO cells, evaluating DNA methylation by microarray and monitoring the expression of XIST and imprinted genes IGF2, H19, and PEG10. Whereas imprinted genes showed biallelic expression in HCT116-5-aza-CdR and DKO cells, the XIST locus was hypomethylated and weakly expressed only under acute hypomethylation conditions, indicating the importance ofXIST repression in the active X to cell survival. Given that DNMT3A is the only active DNMT in DKO cells, it may be responsible for ensuring the repression of XIST in those cells. Taken together, our data suggest that XIST repression is more tightly controlled than genomic imprinting and, at least in part, is due to DNMT3A.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In 2001, an autochthonous case of dual viremia, resulting from naturally acquired dengue virus DEN-1 and DEN-2 infections was detected during the dengue outbreak that occurred in Barretos, a city with about 105,000 inhabitants in the North region of São Paulo State. Serotype identification was based on virus isolation to C6/36 mosquito cells culture and immunofluorescence assays using type-specific monoclonal antibodies. The double infection was also confirmed by reverse transcriptase polymerase chain reaction (RT-PCR). Comparative analysis of the 240-nucleotide sequences of E/NS1 gene junction region between the genome of DEN-1 and DEN-2 isolates of the corresponding reference Nauru and PR 159S1 strains, respectively, showed some nucleotide differences, mainly silent mutations in the third codon position. Results of maximum likelihood phylogenetic analysis of E/NS1 gene sequences indicated that both genotypes of DEN-1 and DEN-2 viruses recovered from double infection in Barretos belonged to genotypes I and III, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of the present study was to evaluate the usefulness of molecular methodologies to access human papillomavirus genome in the genital tract. Samples from 136 women aged 17 to 52 years old obtained from the Dr. Sérgio Franco Laboratories between 2000 and 2001, were analyzed by the hybrid capture assay and amplified by PCR with generic primers MY09/MY11 and specific primers for types 16, 18, 31, 33, 35, 58. Viral genome was detected in 71.3% of the samples by hybrid capture and 75% by amplification. When cytopathology was used as a reference method for screening lesions, hybrid capture (p=0) and amplification (p=0.002) presented positive association. The 3 methods showed absolute agreement when cytopathology confirmed papillomavirus infection and high grade intraepithelial lesion. Disagreements occurred for 10 cases: seven inflammatory cases positive by PCR and negative for hybrid capture and 3 low squamous intraepithelial lesions positive for hybrid capture but negative for amplification. In conclusion, hybrid capture was shown to be sensitive and specific enough for use in clinical routines. Moreover, the evaluation of viral load values obtained by this method were shown to be related to the severity of the lesion and merit further studies to analyze the possible association with risk of progression to malignancy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

INTRODUCTION: The aim of the present study was to evaluate the presence of arboviruses from the Flavivirus genus in asymptomatic free-living non-human primates (NHPs) living in close contact with humans and vectors in the States of Paraná and Mato Grosso do Sul, Brazil. METHODS: NHP sera samples (total n = 80, Alouatta spp. n = 07, Callithrix spp. n = 29 and Sapajus spp. n = 44) were screened for the presence of viral genomes using reverse transcription polymerase chain reaction and 10% polyacrylamide gel electrophoresis techniques. RESULTS: All of the samples were negative for the Flavivirus genome following the 10% polyacrylamide gel electrophoresis analysis. CONCLUSIONS: These negative results indicate that the analyzed animals were not infected with arboviruses from the Flavivirus genus and did not represent a risk for viral transmission through vectors during the period in which the samples were collected.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

"The host-parasite relationship" is a vast and diverse research field which, despite huge human and financial input over many years, remains largely shrouded in mystery. Clearly, the adaptation of parasites to their different host species, and to the different environmental stresses that they represent, depends on interactions with, and responses to, various molecules of host and/or parasite origin. The schistosome genome project is a primary strategy to reach the goal; this systematic research project has successfully developed novel technologies for qualitative and quantitative characterization of schistosome genes and genome organization by extensive international collaboration between top quality laboratories. Schistosomes are a family of parasitic blood flukes (Phylum Platyhelminthes), which have seven pairs of autosomal chromosomes and one pair of sex chromosomes (ZZ for a male worm and ZW for a female), of a haploid genome size of 2.7x108 base pairs (Simpson et al. 1982). Schistosomes are ideal model organisms for the development of genome mapping strategies since they have a small genome size comparable to that of well-characterized model organisms such as Caenorhabditis elegans (100 Mb) and Drosophila (165 Mb), and contain functional genes with a high level of homology to the host mammalian genes. Here we summarize the current progress in the schistosome genome project, the information of 3,047 transcribed genes (Expressed Sequence Tags; EST), complete sets of cDNA and genomic DNA libraries (including YAC and cosmid libraries) with a mapping technique to the well defined schistosome chromosomes. The schistosome genome project will further identify and characterize the key molecules that are responsible for host-parasite adaptation, i.e., successful growth, development, maturation and reproduction of the parasite within its host in the near future