American tegumentary leishmaniasis: langerhans cells in montenegro skin test

This work analyzed the histopathology and epidermal Langerhans cells (LC) of Montenegro skin test (MST) in patients with American tegumentary leishmaniasis (ATL) in order to in situ characterize and compare the immunological reaction of the two major clinical forms of ATL, localized cutaneous leishmaniasis (LCL) and mucocutaneous leishmaniasis (MCL). MST histopathology of both LCL and MCL showed superficial and deep perivascular inflammatory infiltrate composed mainly of lymphocytes and histiocytes. Epidermal LC population was higher in MST biopsies taken from LCL patients when compared to MCL group, at 48 and 72 hours after antigen inoculation. Increased number of epidermal LC displayed in MST biopsies of LCL patients represents specific cellular immunity against parasites. The decrease of LC in MST biopsies of MCL patients does not necessarily indicate a worse specific cellular immunity in this clinical form of leishmaniasis.

Normal skin of HIV-infected individuals contains increased numbers of dermal CD8 T cells and normal numbers of Langerhans cells

Dysregulation of the skin immune system (SIS) could explain the high prevalence of skin disorders in HIV+ individuals. The present study was carried out to determine whether alterations in the cell population of SIS and epidermal immunoactivation occur in the normal skin of HIV+ individuals. Forty-five biopsies were taken from the normal upper arm skin of 45 HIV+ patients and of 15 healthy controls. HIV+ individuals were divided into three categories according to their CD4 cell blood count (<200, 200-499 and ³500/µl). Hematoxylin-eosin was used to stain tissue sections for morphological analysis and immunohistochemistry was used for the evaluation of the frequency of macrophages, Langerhans cells, and CD lymphocyte subsets. In addition, semiquantitative analysis of LFA-1, ICAM-1 and HLA-DR was determined in epidermal cells. Macrophages, Langerhans cells, and CD lymphocyte subsets did not differ significantly between any of the patient categories and the control group. When all HIV+ individuals were compared as a group to the control group, a significant increase in dermal CD8+ T lymphocytes (P < 0.01) and lower CD4-CD8 ratios (P < 0.01) were observed in the HIV+ individuals. Epidermal ICAM-1 and HLA-DR expression was negative in both HIV+ and normal skin biopsies. No evidence of a depletion of the SIS population or of epidermal immunoactivation in normal skin from HIV+ individuals was demonstrable, suggesting that alterations in the central immune system are not necessarily reflected in the SIS of HIV-infected patients.

Immunopathology of american cutaneous leishmaniasis. Modulation of MHC class II gene products by Keratinocytes before and after glucantime therapy

Epidermal changes from 32 cutaneous and 3 mucosal American leishmaniasis (ACL) active lesions were studied for HLA-DR, -DP expression, Lanerhans cells and lymphocyte infiltration. In addition to a DR and DQ positivity at the surface of the cells of the inflammatory infiltrate, a strong reaction for DR antigens was detected on keratinocytes. Hyperplasia of Langerhans cells was present in al cutaneous lesions and epidermis was infiltrated by T lymphocytes. When healed lesions of 14 of these subjects were re-biopsied 1 to 12 months after the end of pentavalent antimonial therapy, MHC class antigens could no longer be seen on keratinocytes. Our data represrn evidence for hhe reversibility of the abnormal HLA-DR expression by keratinocytes in ACL after Glucantime therapy or spontaneous scar formation, demonstrating that this expresion is restricted to the period of active lesions. The present findings can be regarded as an indirect evidence that keratinocytes may be involved in the immunopathology of ACL.

Dermal dendritic cell number correlates with serum autoantibody titers in Brazilian pemphigus foliaceus patients

Pemphigus foliaceus (PF) is an autoimmune bullous disease endemic in Brazil. Since serum IL-12 is increased in patients with PF and Langerhans cells (LC) produce IL-12, we titrated serum autoantibodies by indirect immunofluorescence, and quantified epidermal dendritic cells, known as LC, and dermal dendritic cells (DC). Biopsies of blistering lesions were obtained from 22 patients, 13 of whom were submitted to biopsy of both injured and of apparently healthy skin. The control groups consisted of skin from 8 cadavers and from 12 women submitted to breast plastic surgery. LC and DC were identified with anti-CD1a antibody and quantified by morphometric analysis. LC number in the lesion and in apparently healthy skin from PF patients was similar to that of both control groups. DC number in the injured skin (median = 0.94 DC/mm basement membrane) was higher than that of the cadaver group (median = 0.13 DC/mm basement membrane). In the 13 patients with biopsies of both injured and apparently healthy skin, LC and DC were present in larger numbers in the lesion. There was a direct correlation between DC number in the lesion of the PF group and serum autoantibody titers. This correlation was not observed for LC number. The increased number of DC in the lesion, as well as its direct correlation with serum autoantibody titers suggest the participation of DC in the pathogenesis of PF. The relationship between increased DC number and IL-12 in PF needs to be clarified.

The hamster cheek pouch: an immunologically privileged site suitable to the study of granulomatous infections

The hamster check pouch is an invagination of oral mucosa, characterized histologically as skin-like. In this paper we describe anatomical, histological and embriological features of the pouch and coment on the pouch as an immunologically privileged site since it lacks lymphatic drainage and has few Langerhans cells. We present the review from literature and our observations after inoculation in the pouch of mycobacteriae (BCG, Mycobacterium tuberculosis and Mycobacterium leprae) and a fungus (Paracoccidioides brasiliensis). Lesions in the pouch were granulomatous but smaller and long lasting; even granulomatous, the reaction was inefficient to control the proliferation of agents compared with inoculation in other sites, except for BCG. Appearance of immunity was also delayed or absent and, when it was detected, a sharp decrease in number of agents in pouch lesions was observed. These observations make the pouch an interesting site for the study of the role of immune system in infeccious diseases and in granuloma formation.

The pattern of immune cell infiltration in chromoblastomycosis: involvement of macrophage inflammatory protein-1 alpha/CCL3 and fungi persistence

Chromoblastomycosis (CR) is a subcutaneous chronic mycosis characterized by a granulomatous inflammatory response. However, little is known regarding the pattern of leukocyte subsets in CR and the pathways involved in their recruitment. The objective of this study was to assess the cellular subsets, chemokine, chemokine receptors and enzymes in CR. The inflammatory infiltrate was characterized by immunohistochemistry using antibodies against macrophages (CD68), Langerhans'cells (S100), lymphocytes (CD3, CD4, CD8, CD45RO, CD20 and CD56) and neutrophils (CD15). The expression of MIP-1alpha (Macrophage inflammatory protein-1alpha), chemokine receptors (CXCR3 and CCR1) and enzymes (superoxide dismutase-SOD and nitric oxide synthase-iNOS) was also evaluated by the same method. We observed an increase in all populations evaluated when compared with the controls. Numbers of CD15+ and CD56+ were significantly lower than CD3+, CD4+, CD20+ and CD68+ cells. Statistical analysis revealed an association of fungi numbers with CD3, CD45RO and iNOS-positive cells. Furthermore, MIP-1alpha expression was associated with CD45RO, CD68, iNOS and CXCR3. Our results suggest a possible role of MIP-1alpha and fungi persistence in the cell infiltration in CR sites.

Genetic characterisation of Langerin gene in human immunodeficiency virus-1-infected women from Bahia, Brazil

Studies on human genetic variations are a useful source of knowledge about human immunodeficiency virus (HIV)-1 infection. The Langerin protein, found at the surface of Langerhans cells, has an important protective role in HIV-1 infection. Differences in Langerin function due to host genetic factors could influence susceptibility to HIV-1 infection. To verify the frequency of mutations in the Langerin gene, 118 samples from HIV-1-infected women and 99 samples from HIV-1-uninfected individuals were selected for sequencing of the promoter and carbohydrate recognition domain (CRD)-encoding regions of the Langerin gene. Langerin promoter analysis revealed two single nucleotide polymorphisms (SNPs) and one mutation in both studied groups, which created new binding sites for certain transcription factors, such as NFAT5, HOXB9.01 and STAT6.01, according to MatInspector software analysis. Three SNPs were observed in the CRD-encoding region in HIV-1-infected and uninfected individuals: p.K313I, c.941C>T and c.983C>T. This study shows that mutations in the Langerin gene are present in the analysed populations at different genotypic and allelic frequencies. Further studies should be conducted to verify the role of these mutations in HIV-1 susceptibility.

Anatomy, ultrastructure and secretion of Hibiscus pernambucensis Arruda (Malvaceae) extrafloral nectary

This paper reports on the extrafloral nectary (EFN) of Hibiscus pernambucensis, a native shrub species occurring in mangrove and restinga along Brazil's coastline. EFNs occur as furrows with a protuberant border on the abaxial surface veins of the leaf blade. Each nectary consists of numerous secretory multicellular trichomes, epidermal cells in palisade-like arrangements and non-vascularized parenchyma tissue. Nectar secretion is prolonged, since secretion starts in very young leaves and remains up to completely expanded leaves. Reduced sugars, lipids, and proteins were histochemically detected in all the nectary cells; phenolic substances were detected in the vacuoles of the epidermal palisade cells and in some secretory trichome cells. The secretory cells that constitute the body of trichomes have large nuclei, dense cytoplasm with numerous mitochondria, dictyosomes, scattered lipid droplets and plastids with different inclusions: protein, lipid droplets or starch grains; vacuoles with different sizes have membranous material, phenolic and lipophilic substances. The palisade cells show thick periclinal walls, reduced cytoplasm with voluminous lipid drops and developed vacuoles. The nectary parenchyma cells contain abundant plasmodesmata and cytoplasm with scattered lipid droplets, mitochondria, plastids with starch grains and endoplasmic reticulum. Mucilage idioblasts are common in the inner nectary parenchyma. Protoderm and ground meristem participate in the formation of EFN. Our data indicate that all nectary regions are involved in nectar production and secretion, constituting a functional unit. Longevity of the extrafloral nectaries is likely associated with the presence of mucilage idioblasts, which increases the capacity of the nectary parenchyma to store water.

Atypical epidermal alterations in chronic Leishmania mexicana mexicana lesions fo C3H mice

C3H mice chronically infected with Leishmania m. mexicana, and in some groups treated with BCG or levamisole, presented atypical epidermal alterations, including pseudoepitheliomatous hyperplasia, hyperkeratosis and dysplasia. These alterations increased in frequency and intensity during the course of infection, but were not related to lesion size or tissue parasite load. Age matched normal, BCG and levamisole treated control mice, examined simultaneously, did not show epidermal modifications. In infected mice the dermis and hypodermis presented an inflammatory infiltrate of histiocytes, lymphocytes and plasma cells, accompanied at times by neutrophils and eosinophils, which did not vary with duration of infection.

Necrotrophic fungi associated with epidermal microcracking caused by chilling injury in pickling cucumber fruit

The objective of this work was to visualize the association between microcracking and other epidermal chilling injury symptoms, and to identify rots in cucumber fruit (Cucumis sativus L.) by scanning electron microscopy (SEM). Depressed epidermal areas and surface cracking due to damages of subepidermal cells characterized the onset of pitting in cucumber fruit. The germination of conidia of Alternaria alternata, with some of them evident on the fractures in the cultivar Trópico, occurred after damaging on the epidermis. Before, the chilling injury symptoms became visible, Stemphylium herbarum conidia germinated, and mycelium penetrated through the hypodermis using the microcracks as pathway. In the cultivar Perichán 121 the fungus was identified as Botrytis cinerea.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Cell cycle synchronization and BrdU incorporation as a tool to study the possible selective elimination of ErbB1 gene in the micronuclei in A549 cells

Lung cancer often exhibits molecular changes, such as the overexpression of the ErbB1 gene that encodes epidermal growth factor receptor (EGFR). ErbB1 amplification and mutation are associated with tumor aggressiveness and low response to therapy. The aim of the present study was to design a schedule to synchronize the cell cycle of A549 cell line (a non-small cell lung cancer) and to analyze the possible association between the micronuclei (MNs) and the extrusion of ErbB1 gene extra-copies. After double blocking, by the process of fetal bovine serum deprivation and vincristine treatment, MNs formation was monitored with 5-bromo-2-deoxyuridine (BrdU) incorporation, which is an S-phase marker. Statistical analyses allowed us to infer that MNs may arise both in mitosis as well as in interphase. The MNs were able to replicate their DNA and this process seemed to be non-synchronous with the main cell nuclei. The presence of ErbB1 gene in the MNs was evaluated by fluorescent in situ hybridization (FISH). ErbB1 sequences were detected in the MNs, but a relation between the MNs formation and extrusion of amplified ErbB1could not be established. The present study sought to elucidate the meaning of MNs formation and its association with the elimination of oncogenes or other amplified sequences from the tumor cells.

MFG-E8, a clearance glycoprotein of apoptotic cells, as a new marker of disease severity in chronic obstructive pulmonary disease

Milk fat globule epidermal growth factor 8 (MFG-E8) is an opsonin involved in the phagocytosis of apoptotic cells. In patients with chronic obstructive pulmonary disease (COPD), apoptotic cell clearance is defective. However, whether aberrant MFG-E8 expression is involved in this defect is unknown. In this study, we examined the expression of MFG-E8 in COPD patients. MFG-E8, interleukin (IL)-1β and transforming growth factor (TGF)-β levels were measured in the plasma of 96 COPD patients (93 males, 3 females; age range: 62.12±10.39) and 87 age-matched healthy controls (85 males, 2 females; age range: 64.81±10.11 years) using an enzyme-linked immunosorbent assay. Compared with controls, COPD patients had a significantly lower plasma MFG-E8 levels (P<0.01) and significantly higher plasma TGF-β levels (P=0.002), whereas there was no difference in plasma IL-1β levels between the two groups. Moreover, plasma MFG-E8 levels decreased progressively between Global Initiative for Chronic Obstructive Lung Disease (GOLD) I and GOLD IV stage COPD. Multiple regression analysis showed that the forced expiratory volume in 1 s (FEV1 % predicted) and smoking habit were powerful predictors of MFG-E8 in COPD (P<0.01 and P=0.026, respectively). MFG-E8 was positively associated with the FEV1 % predicted and negatively associated with smoking habit. The area under the receiver operating characteristic curve was 0.874 (95% confidence interval: 0.798-0.95; P<0.01). Our findings demonstrated the utility of MFG-E8 as a marker of disease severity in COPD and that cigarette smoke impaired MFG-E8 expression in these patients.

Células de Langerhans no epitélio da prega vocal humana: estudo imunoistoquímico

Células de Langerhans (CL) são um tipo de células dendríticas que têm funções que envolvem apresentação de antígeno e a estimulação de resposta T dependente. Elas representam aproximadamente 4% das células do epitélio laríngeo. OBJETIVO: Identificar a presença de CL no epitélio das pregas vocais, comparar suas subpopulações, bem com comparar a capacidade de quatro marcadores imunoistoquímicos. FORMA DE ESTUDO: Experimental. CASUÍSTICA E MÉTODO: Seis cadáveres, 3 homens e 3 mulheres foram estudados. Foram analisadas amostras de pele e das pregas vocais coradas e imunomarcadas para vimentina, proteína S-100, CD-68 e fascina. Após análise histológica, foi realizado o teste t de Student e análise de variância no estudo estatístico. RESULTADOS E CONCLUSÕES: Foi possível identificar a presença de CL no epitélio das pregas vocais de humanos não fumantes de ambos os sexos. A fascina, a vimentina o CD-68 mostraram-se bons marcadores das CL, enquanto a proteína S-100 teve estatisticamente menor poder de marcação tanto na prega vocal (p=0,01) como na pele (p=0,02). Foi possível identificar três diferentes subpopulações de CL presentes tanto na prega vocal como na pele destes indivíduos, contudo apenas na pele observarmos maior quantidade estatisticamente significante na camada basal do epitélio.

Biochemical and morpho-anatomical analyses of strawberry vitroplants hyperhydric tissues affected by BA and gelling agents

In vitro propagation has become an effective practice for large-scale production of strawberry plants. The objective of this study was to evaluate the hyperhydricity and the multiplication capacity of two strawberry varieties (Fragaria x ananassa Duch. 'Dover' and 'Burkley') propagated in vitro. Plants maintained in MS medium supplemented with 1.0 mg L-1 BA were individualized and transferred to the same medium solidified with Agar (6.5 g L-1) or Phytagel® (2.5 g L-1) and BA at different concentrations (0; 0.5; 1.0; 2.0 and 3.0 mg L-1). Biochemical and anatomical analyses were carried out, as well as the analysis of the morphological hyperhydricity characteristics. The analysis of data showed: a) the increase in cytokinin concentration increased hyperhydricity frequency in both varieties; b) at concentrations up to 2.0 mg L-1 BA, the replacement of Agar by Phytagel® induced a higher formation of hyperhydric shoots; and c) the addition of BA induced oxidative stress, which is characterized by increased antioxidant activity and lipid peroxidation, as well as alterations at the cellular level, such as malformation of stomata and epidermal cells. In conclusion, the culture medium containing 0.5 mg L-1 BA solidified with Agar provided lower hyperhydricity percentages in association with higher rates of shoot proliferation in strawberry.