Polymerase chain reaction amplification of genomic fragments of bovine herpesvirus-1

Especial conditions were developed for the amplification of five DNA segments from US region of BHV-1 by polymerase chain reaction. In order to eliminate most nonspecific products it was found that addition of three cosolvents DMSO, glycerol and NP 40 was a simple method for increasing the specificity of amplification.

Genomic rearrangements in trypanosomatids: an alternative to the "one gene" evolutionary hypotheses?

Most molecular trees of trypanosomatids are based on point mutations within DNA sequences. In contrast, there are very few evolutionary studies considering DNA (re) arrangement as genetic characters. Waiting for the completion of the various parasite genome projects, first information may already be obtained from chromosome size-polymorphism, using the appropriate algorithms for data processing. Three illustrative models are presented here. First, the case of Leishmania (Viannia) braziliensis/L. (V.) peruviana is described. Thanks to a fast evolution rate (due essentially to amplification/deletion of tandemly repeated genes), molecular karyotyping seems particularly appropriate for studying recent evolutionary divergence, including eco-geographical diversification. Secondly, karyotype evolution is considered at the level of whole genus Leishmania. Despite the fast chromosome evolution rate, there is qualitative congruence with MLEE- and RAPD-based evolutionary hypotheses. Significant differences may be observed between major lineages, likely corresponding to major and less frequent rearrangements (fusion/fission, translocation). Thirdly, comparison is made with Trypanosoma cruzi. Again congruence is observed with other hypotheses and major lineages are delineated by significant chromosome rearrangements. The level of karyotype polymorphism within that "species" is similar to the one observed in "genus" Leishmania. The relativity of the species concept among these two groups of parasites is discussed.

Characterization of new Schistosoma mansoni microsatellite loci in sequences obtained from public DNA databases and microsatellite enriched genomic libraries

In the last decade microsatellites have become one of the most useful genetic markers used in a large number of organisms due to their abundance and high level of polymorphism. Microsatellites have been used for individual identification, paternity tests, forensic studies and population genetics. Data on microsatellite abundance comes preferentially from microsatellite enriched libraries and DNA sequence databases. We have conducted a search in GenBank of more than 16,000 Schistosoma mansoni ESTs and 42,000 BAC sequences. In addition, we obtained 300 sequences from CA and AT microsatellite enriched genomic libraries. The sequences were searched for simple repeats using the RepeatMasker software. Of 16,022 ESTs, we detected 481 (3%) sequences that contained 622 microsatellites (434 perfect, 164 imperfect and 24 compounds). Of the 481 ESTs, 194 were grouped in 63 clusters containing 2 to 15 ESTs per cluster. Polymorphisms were observed in 16 clusters. The 287 remaining ESTs were orphan sequences. Of the 42,017 BAC end sequences, 1,598 (3.8%) contained microsatellites (2,335 perfect, 287 imperfect and 79 compounds). The 1,598 BAC end sequences 80 were grouped into 17 clusters containing 3 to 17 BAC end sequences per cluster. Microsatellites were present in 67 out of 300 sequences from microsatellite enriched libraries (55 perfect, 38 imperfect and 15 compounds). From all of the observed loci 55 were selected for having the longest perfect repeats and flanking regions that allowed the design of primers for PCR amplification. Additionally we describe two new polymorphic microsatellite loci.

Genomic characterization of a Brazilian TT Virus isolate closely related to SEN virus-F

SEN virus (SENV) is a circular, single stranded DNA virus that has been first characterized in the serum of a human immunodeficiency virus type 1 (HIV-1)-infected patient. Eight genotypes of SENV (A-H) have been identified and further recognized as variants of TT virus (TTV) in the family Circoviridae. Here we describe the first genomic characterization of a SENV isolate (5-A) from South America. Using 'universal' primers, able to amplify most, if not all, TTV/SENV genotypes, a segment of > 3 kb was amplified by polymerase chain reaction from the serum of an HIV-1 infected patient. The amplicon was cloned and a 3087-nucleotide sequence was determined, that showed a high (85%) homology with the sequence of the Italian isolate SENV-F. Proteins encoded by open reading frames (ORFs) 1 to 4 consisted of 758, 129, 276, and 267 amino acids, respectively. By phylogenetic analysis, isolate 5-A was classified into TTV genotype 19 (phylogenetic group 3), together with SENV-F and TTV isolate SAa-38.

Perspectives in the control of infectious diseases by transgenic mosquitoes in the post-genomic era: a review

Arthropod-borne diseases caused by a variety of microorganisms such as dengue virus and malaria parasites afflict billions of people worldwide imposing major economic and social burdens. Despite many efforts, vaccines against diseases transmitted by mosquitoes, with the exception of yellow fever, are not available. Control of such infectious pathogens is mainly performed by vector management and treatment of affected individuals with drugs. However, the numbers of insecticide-resistant insects and drug-resistant parasites are increasing. Therefore, inspired in recent years by a lot of new data produced by genomics and post-genomics research, several scientific groups have been working on different strategies to control infectious arthropod-borne diseases. This review focuses on recent advances and perspectives towards construction of transgenic mosquitoes refractory to malaria parasites and dengue virus transmission.

Antigenic and genomic characterization of adenovirus associated to respiratory infections in children living in Northeast Brazil

From January to December 1998, nasopharyngeal aspirates were obtained from 482 children with acute respiratory infections attended in emergence department and wards of a teaching hospital in the city of Salvador, Brazil. The samples were tested for the presence of adenovirus by isolation in tissue culture and indirect immunofluorescence assay. Eleven adenoviruses were detected by both methods in the same clinical samples. Infections by adenovirus were observed during seven months of the year without association with rainy season. Genome analysis was performed on these 11 isolates. Species C was represented by serotypes 1, 2 and 5. Within species B, only serotype 7 (Ad7) was detected. Two genomic variants of Ad1, two variants of Ad2, one of Ad5, and one of Ad7 (7h) were identified. This is the first study of molecular epidemiology of adenovirus associated to acute respiratory infections in children living in Northeast Brazil, and contributes to a better understanding of adenovirus infections in the country.

Genetic relationships between sympatric populations of Bacillus cereus and Bacillus thuringiensis, as revealed by rep-PCR genomic fingerprinting

The bacterial strain Bacillus cereus is closely related to Bacillus thuringiensis, although any genetic relationship between the two strains is still in debate. Using rep-PCR genomic fingerprinting, we established the genetic relationships between Brazilian sympatric populations of B. cereus and B. thuringiensis simultaneously collected from two geographically separate sites. We observed the formation of both B. thuringiensis and B. cereus clusters, as well as strains of B. cereus that are more closely related to B. thuringiensis than to other B. cereus strains. In addition, lower genetic variability was observed among B. thuringiensis clusters compared to B. cereus clusters, indicating that either the two species should be categorized as separate or that B. thuringiensis may represent a clone from a B. cereus background.

Full-length genomic sequence of hepatitis B virus genotype C2 isolated from a native Brazilian patient

The hepatitis B virus (HBV) is among the leading causes of chronic hepatitis, cirrhosis and hepatocellular carcinoma. In Brazil, genotype A is the most frequent, followed by genotypes D and F. Genotypes B and C are found in Brazil exclusively among Asian patients and their descendants. The aim of this study was to sequence the entire HBV genome of a Caucasian patient infected with HBV/C2 and to infer the origin of the virus based on sequencing analysis. The sequence of this Brazilian isolate was grouped with four other sequences described in China. The sequence of this patient is the first complete genome of HBV/C2 reported in Brazil.

Genomic analysis of a nontoxigenic, invasive Corynebacterium diphtheriae strain from Brazil

We report the complete genome sequence and analysis of an invasive Corynebacterium diphtheriae strain that caused endocarditis in Rio de Janeiro, Brazil. It was selected for sequencing on the basis of the current relevance of nontoxigenic strains for public health. The genomic information was explored in the context of diversity, plasticity and genetic relatedness with other contemporary strains.

Root system distribution of sugar cane as related to nitrogen fertilization, evaluated by two methods: monolith and probes

Few studies on sugar cane have evaluated the root system of the crop, in spite of its importance. This is mainly due to the difficulty of evaluation and high variability of results. The objective of this study was to develop an evaluation method of the cane root system by means of probes so as to evaluate the mass, distribution and metabolically active roots related to N fertilization at planting. For this purpose, an experiment was conducted in an Arenic Kandiustults with medium texture in Jaboticabal/SP, in a randomized block design with four replications and four treatments: control (without N) and 40, 80 and 120 kg ha-1 of N applied in the form of urea in the planting furrow of the cane variety SP81 3250. One week before harvest, a urea-15N solution was applied at the cane stalk base to detect active metabolism in the root system. Trenches of 1.5 m length and 0.6 m depth were opened between two sugar cane rows for root sampling by two methods: monoliths (0.3, 0.2 and 0.15 m wide, deep and long respectively) taken from the trench wall and by probe (internal diameter 0.055 m). For each method, 15 samples per plot were collected. The roots were separated from the soil in a sieve (2 mm mesh), oven-dried (at 65 ºC) and the dry matter was measured. Root sampling by probes resulted in root mass that did not differ from the evaluation in monoliths, indicating that this evaluation method may be used for sugar cane root mass, although neither the root distribution in the soil profile nor the rhizome mass were efficiently evaluated, due to the small sample volume. Nitrogen fertilization at planting did not result in a greater root accumulation in the sugar cane plant, but caused changes in the distribution of the root system in the soil. The absence of N fertilization led to a better root distribution in the soil profile, with 50, 34 and 16 % in the 0-0.2, 0.2-0.4 and 0.4-0.6 m layers, respectively; in the fertilized treatments the roots were concentrated in the surface layer, with on average 70, 17 and 13 % for the same layers. The metabolically active roots were concentrated in the center of the cane stool, amounting to 40 % of the total root mass, regardless of N fertilization (application of 120 kg ha-1 N or without N).

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Genetic diversity of Brazilian triticales evaluated with genomic wheat microsatellites

The objective of this work was to determine the genetic variability available for triticale (X Triticosecale Wittmack) crop improvement in Brazil. Forty-two wheat genomic microsatellites were used to estimate the molecular diversity of 54 genotypes, which constitute the base of one of the major triticale breeding programs in the country. Average heterozygosity was 0.06 and average and effective number of alleles per locus were 2.13 and 1.61, respectively, with average allelic frequency of 0.34. The set of genomic wheat microsatellites used clustered the genotypes into seven groups, even when the germplasm was originated primarily from only two triticale breeding programs, a fact reflected on the average polymorphic information content value estimated for the germplasm (0.36). The 71.42% transferability achieved for the tested microsatellites indicates the possibility of exploiting these transferable markers in further triticale genetic and breeding studies, even those mapped on the D genome of wheat, when analyzing hexaploid triticales.

Genomic behavior of hybrid combinations between elephant grass and pearl millet

The objective of this work was to evaluate the genomic behavior of hybrid combinations between elephant grass (Pennisetum purpureum) and pearl millet (P. glaucum). Tetraploid (AAA'B) and pentaploid (AA'A'BB) chromosome races resulting from the backcross of the hexaploid hybrid to its parents elephant grass (A'A'BB) and pearl millet (AA) were analyzed as to chromosome number and DNA content. Genotypes of elephant grass, millet, and triploid and hexaploid induced hybrids were compared. Pentaploid and tetraploid genomic combinations showed high level of mixoploidy, in discordance with the expected somatic chromosome set. The pentaploid chromosome number ranged from 20 to 34, and the tetraploid chromosome number from 16 to 28. Chromosome number variation was higher in pentaploid genomic combinations than in tetraploid, and mixoploidy was observed among hexaploids. Genomic combinations 4x and 5x are mixoploid, and the variation of chromosome number within chromosomal race 5x is greater than in 4x.

Breeding, genetic and genomic of citrus for disease resistance

Although the citriculture is one of the most important economic activities in Brazil, it is based on a small number of varieties. This fact has contributed for the vulnerability of the culture regarding the phytosanitary problems. A higher number of varieties/genotypes with potential for commercial growing, either for the industry or fresh market, has been one of the main objectives of citrus breeding programs. The genetic breeding of citrus has improved, in the last decades, due to the possibility of an association between biotechnological tools and classical methods of breeding. The use of molecular markers for early selection of zygotic seedlings from controlled crosses resulted in the possibility of selection of a high number of new combination and, as a consequence, the establishment of a great number of hybrids in field experiments. The faster new tools are incorporated in the program, the faster is possibility to reach new genotypes that can be tested as a new variety. Good traits should be kept or incorporate, whereas bad traits have to be excluded or minimized in the new genotype. Scion and rootstock can not be considered separately, and graft compatibility, fruit quality and productivity are essential traits to be evaluated in the last stages of the program. The mapping of QTLs has favored breeding programs of several perennial species and in citrus it was possible to map several characteristics with qualitative and quantitative inheritance. The existence of linkage maps and QTLs already mapped, the development of EST and BAC library and the sequencing of the Citrus complete genome altogether make very demanding and urgent the exploration of such data to launch a wider genetic study of citrus. The rising of information on genome of several organisms has opened new approaches looking for integration between breeding, genetic and genome. Genome assisted selection (GAS) involves more than gene or complete genome sequencing and is becoming an import support in breeding programs of annual and perennial species. An huge information amount can be derivate from genome analysis. The use and benefit of such informations will depend on the genetic basis of the breeding program.