58 resultados para Equivalence-preserving


Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: Schizophrenia is a chronic mental disorder associated with impairment in social functioning. The most widely used scale to measure social functioning is the GAF (Global Assessment of Functioning), but it has the disadvantage of measuring at the same time symptoms and functioning, as described in its anchors. OBJECTIVES:Translation and cultural adaptation of the PSP, proposing a final version in Portuguese for use in Brazil. METHODS: We performed five steps: 1) translation; 2) back translation; 3) formal assessment of semantic equivalence; 4) debriefing; 5) analysis by experts. Interrater reliability (Intraclass correlation, ICC) between two raters was also measured. RESULTS: The final version was applied by two independent investigators in 18 adults with schizophrenia (DSM-IV-TR). The interrater reliability (ICC) was 0.812 (p < 0.001). CONCLUSION: The translation and adaptation of the PSP had an adequate level of semantic equivalence between the Portuguese version and the original English version. There were no difficulties related to understanding the content expressed in the translated texts and terms. Its application was easy and it showed a good interrater reliability. The PSP is a valid instrument for the measurement of personal and social functioning in schizophrenia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: Patients' perception about their health condition, mainly involving chronic diseases, has been investigated in many studies and it has been associated to depression, compliance with the treatment, quality of life and prognosis. The Illness Effects Questionnaire (IEQ) is a tool which makes the standardized evaluation of patients' perception about their illness possible, so that it is brief and accessible to the different clinical settings. This work aims to begin the transcultural adaptation of the IEQ to Brazil through the validated translation and the reliability study. METHODS: The back-translation method and the test-retest reliability study were used in a sample of 30 adult patients under chronic hemodialysis. The reliability indexes were estimated using the Pearson, Spearman, Weighted Kappa and Cronbach's alpha coefficients. RESULTS: The semantic equivalence was reached through the validated translation. In this study, the reliability indexes obtained were respectively: 0.85 and 0.75 (p < 0.001); 0.68 and 0.92 (p < 0.0001). DISCUSSION: The reliability indexes obtained attest to the stability of responses in both evaluations. Additional procedures are necessary for the transcultural adaptation of the IEQ to be complete. CONCLUSION: The results indicate the translation validity and the reliability of the Brazilian version of the IEQ for the sample studied.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new species of pulmonate snail was recently collected in a small forest fragment in the city of Bom Jesus da Lapa, Bahia state, Brazil. Bahia is known for a high diversity of land snails and Bom Jesus da Lapa is an interesting locality, since it is close to the interface between two major Brazilian biomes: Cerrado and Caatinga. The new species is described as Cyclodontina tapuia sp. nov. and can be easily identified by its brown shell, conical spire, convex whorls, a sculpture comprised of strong ribs, and an aperture with four barriers: a median parietal tooth, a median palatal tooth, a median basal tooth and a strong columellar lamella. This discovery is also a reminder of how little the Brazilian continental molluscan fauna is known and of the urgency in studying and preserving the rich (though usually overlooked) fauna of the Caatinga.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The classification of salmonellae in accordance with the Kauffmann-White schema accepted by the presents various inconveniences and difficulties to application. Among these is the necessity of preparing, dosing and preserving a considerable number of specific sera whose validity as is well known, is limited. The criterion of Kauffmann’s classification is exclusively, for it abandoned cultural tests, leaving therefore only a unilateral criterion. By following it one might include Chromobacterium typhi-flavum in the Salmonella genus as well as other bacteria which differ completely from the Salmonella, as long as they are antigenically related. On the other hand, the chart approximates or separates in the different groups of antigen O species or types of salmonellae which are biologically close or almost indistinguishable. The chart has given rise to an excessive number of species and lypes of salmonellae which from 44 in the chart approved by the in 1934 rose ro 60 in Bergey’s Manual and everything leads one to believe that the end is not yet for every day new lypes or species are found. And perforce this must be so for new antigenic factors have been found which give rise to new structural combinations. Applying the formula of combinations (formule) to the factors already known, there are probable possibilities of having 260 different antigenic combinations in group A, or 3260 lypes or species if all the flagellate antigens of the other groups should be found, in it combined 2 and 2. Futher applying the formula of combinations to the other groups there would be possibility of so many combinations that the number of salmonellae would exceed the number of known bacterian species or perhaps the number of those existing on earth. Undoubledly Kauffmann-White’s chart is an improvement, but the bacterian analysis made with it was exaggerated and exceeded the limit of the present possibilities of the realities of life. It revealed interesting aspects of the somatic complexity of bacteria but seems untenable because of its use in pratical sense.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In the celebration of the Oswaldo Cruz Institute centenary, we wanted to stress our concern with the relationship between two of its missions: research and education. What are the educational bases required for science and technology activities on health sciences for the future years? How can scientists collaborate to promote the popularization of academic knowledge and to improve a basic education for citizenship in an ethic and humanistic view? In this article we pointed out to need of commitment, even in the biomedical post-graduation level, of a more integrated philosophy that would be centered on health education, assuming health as a dynamic biological and social equilibrium and emphasizing the need of scientific popularization of science in a cooperative construction way, instead of direct transfer of knowledge, preserving also macro views of health problems in the development of very specific studies. The contemporary explosion of knowledge, particularly biological knowledge, imposes a need of continuous education to face the growing illiteracy. In order to face this challenge, we think that the Oswaldo Cruz Institute honors his dialectic profile of tradition and transformation, always creating new perspectives to disseminate scientific culture in innovated forms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Positive Montenegro's skin test is a delayed type hypersensitivity reaction widely used as indicative of previous infection with Leishmania in both humans and dogs. Montenegro's antigen consists of a crude Leishmania antigen solution, usually containing thimerosal as preserving agent. In this work it is shown that a large proportion of dogs (11 out of 56) examined in an endemic area of leishmaniasis presented induration at the site of injection of a diluent containing thimerosal alone. This clearly demonstrates that thimerosal leads to a high number of false positive skin reactions in dogs and that its use in Montenegro's skin test antigenic preparations should be avoided.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The immunogenicity and safety of a new recombinant hepatitis B vaccine from the Instituto Butantan (Butang®) were evaluated in a multicenter, double-blind, prospective equivalence study in three centers in Brazil. Engerix B® was the standard vaccine. A total of 3937 subjects were recruited and 2754 (70%) met all protocol criteria at the end of the study. All the subjects were considered healthy and denied having received hepatitis B vaccine before the study. Study subjects who adhered to the protocol were newborn infants (566), children 1 to 10 years old (484), adolescents from 11 to 19 years (740), adults from 20 to 30 years (568), and adults from 31 to 40 years (396). Vaccine was administered in three doses on the schedule 0, 1, and 6 months (newborn infants, adolescents, and adults) or 0, 1, and 7 months (children). Vaccine dose was intramuscular 10 µg (infants, children, and adolescents) or 20 µg (adults). Percent seroprotection (assumed when anti-HBs titers were > 10mIU/ml) and geometric mean titer (mIU/ml) were: newborn infants, 93.7% and 351.1 (Butang®) and 97.5% and 1530.6 (Engerix B®); children, 100% and 3600.0 (Butang®) and 97.7% and 2753.1 (Engerix B®); adolescents, 95.1% and 746.3 (Butang®) and 96% and 1284.3 (Engerix B®); adults 20-30 years old, 91.8% and 453.5 (Butang®) and 95.5% and 1369.0 (Engerix B®); and adults 31-40 years old, 79.8% and 122.7 (Butang®) and 92.4% and 686.2 (Engerix B®). There were no severe adverse events following either vaccine. The study concluded that Butang® was equivalent to Engerix B® in children, and less immunogenic but acceptable for use in newborn infants, adolescents, and young adults.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Frequent reports on outbreaks of acute Chagas' disease by ingestion of food contaminated with parasites from triatomine insects illustrate the importance of this mode of transmission. Studies on oral Trypanosoma cruzi infection in mice have indicated that metacyclic trypomastigotes invade the gastric mucosal epithelium. A key molecule in this process is gp82, a stage-specific surface glycoprotein that binds to both gastric mucin and to target epithelial cells. By triggering Ca2+ signalling, gp82 promotes parasite internalisation. Gp82 is relatively resistant to peptic digestion at acidic pH, thus preserving the properties critical for oral infection. The infection process is also influenced by gp90, a metacyclic stage-specific molecule that negatively regulates the invasion process. T. cruzi strains expressing high gp90 levels invade cells poorly in vitro. However, their infectivity by oral route varies considerably due to varying susceptibilities of different gp90 isoforms to peptic digestion. Parasites expressing pepsin-susceptible gp90 become highly invasive against target cells upon contact with gastric juice. Such is the case of a T. cruzi isolate from an acute case of orally acquired Chagas' disease; the gp90 from this strain is extensively degraded upon short period of parasite permanence in the gastric milieu. If such an exacerbation of infectivity occurs in humans, it may be responsible for the severity of Chagas' disease reported in outbreaks of oral infection.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

There is a general consensus that during chronic Trypanosoma cruzi infection, the host immune system induces complex processes to ensure the control of parasite growth while preserving the potential to mount and maintain a life-long controlled humoral and cellular immune response against the invading pathogen. This review summarises evidence in an attempt to elucidate "what must be understood" to further clarify the role of innate immunity in the development/maintenance of clinical Chagas disease and the impact of etiological treatment on host immunity, highlighting the contributions of the innate immunity and regulatory T (Treg) cells. Recently, increasing focus on innate immunity suggest that chronic T. cruzi infection may cause morbidity when innate effector functions, or the down-regulation of adaptive regulatory mechanisms are lacking. In this context, stable asymptomatic host-parasite interactions seem to be influenced by the effector/regulatory balance with the participation of macrophages, natural killer (NK) and CD8+ T cells in parallel with the establishment of regulatory mechanisms mediated by NKT and Treg cells. Moreover, a balanced innate immune activation state, apart from Treg cells, may play a role in controlling the adverse events triggered by the massive antigen release induced by trypanosomicidal agents during Chagas disease etiological treatment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

For decades thimerosal has been used as a preservative in the candidate vaccine for cutaneous leishmaniasis, which was developed by Mayrink et al. The use of thimerosal in humans has been banned due to its mercury content. This study addresses the standardization of phenol as a new candidate vaccine preservative. We have found that the proteolytic activity was abolished when the test was conducted using the candidate vaccine added to merthiolate (MtVac) as well as to phenol (PhVac). The Montenegro's skin test conversion rates induced by MtVac and by PhVac was 68.06% and 85.9%, respectively, and these values were statistically significant (p < 0.05). The proliferative response of peripheral mononuclear blood cells shows that the stimulation index of mice immunized with both candidate vaccines was higher than the one in control animals (p < 0.05). The ability of the candidate vaccines to induce protection in C57BL/10 mice against a challenge with infective Leishmania amazonensis promastigotes was tested and the mice immunized with PhVac developed smaller lesions than the mice immunized with MtVac. Electrophoresis of phenol-preserved antigen revealed a number of proteins, which were better preserved in PhVac. These results do in fact encourage the use of phenol for preserving the immunogenic and biochemical properties of the candidate vaccine for cutaneous leishmaniasis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE To translate and culturally adapt to Portuguese the Ferrans and Powers Quality of Life Index Spinal Cord Injury - Version III and characterize the sample in relation to sociodemographic and clinical aspects. METHOD A methodological study with view to cross-cultural adaptation, following the particular steps of this method: initial translation, translation synthesis, back-translation (translation back to the original language), review by a committee of judges and pretest of the final version. The pretest was carried out with 30 patients with spinal cord injury. RESULTS An index of 74 items divided into two parts (satisfaction/importance) was obtained. The criteria of semantic equivalence were evaluated as very adequate translation, higher than 87%, and vocabulary and were grammar higher than 86%. Idiomatic equivalence was higher than 74%, experimental greater than 78% and conceptual was greater than 70%. CONCLUSION After cross-cultural adaptation, the instrument proved semantic, idiomatic, experimental and conceptual adequacy, in addition to helping the evaluation of the quality of life of people with spinal cord injury.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abundace and body size distribution of invertebrates of leaf litter in Amazonian forest, Brazil. Based on 605 invertebrates sampled of the litter in an Amazonian Forest, some basic macroecological patterns for this assemblage were described. The relationship between abundance and body size, at logarithmic scale, was triangular, and the distribution of species was constrained in an asymmetric triangular envelope, that was tested using null model procedures in ECOSIM (P= 0,0002). The most abundant species were at an intermediated body size. The relationship between maximum abundance with different mean body size classes confirmed the Energetic Equivalent Rule (b = -1,069; t-0,75 = -2,13; P = 0.079). This way, species tend to consume energy from the community independent of their body size, since requirements are compensated by local population density.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We hypothesised that, during occlusion inside granular aggregates of oxide-rich soils, the light fraction organic matter would undergo a strong process of decomposition, either due to the slow process of aggregate formation and stabilisation or due to digestion in the macro- and meso-fauna guts. This process would favour the accumulation of recalcitrant materials inside aggregates. The aim of this study was to compare the dynamics and the chemical composition of free and occluded light fraction organic matter in a natural cerrado vegetation (woodland savannah) and a nearby pasture (Brachiaria spp.) to elucidate the transformations during occlusion of light fraction in aggregates of a clayey Oxisol. Nuclear Magnetic Resonance of the 13C, with Cross Polarisation and Magic Angle Spinning (13C-CPMAS-NMR), and 13C/12C isotopic ratio were combined to study organic matter composition and changes in carbon dynamics, respectively. The occluded light fraction had a slower turnover than the free light fraction and the heavy fraction. Organic matter in the occluded fraction also showed a higher degree of decomposition. The results confirm that processes of soil organic matter occlusion in the typical "very fine strong granular" structure of the studied oxide-rich soil led to an intense transformation, selectively preserving stable organic matter. The small amount of organic material stored as occluded light faction, as well as its stability, suggests that this is not an important or manageable sink for sequestration of atmospheric CO2.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Twenty four strains of the entomopathogenic fungi (Hyphomycetes) Beauveria bassiana, Metarrhizium anisopliae, Nomuraea rileyi, Paecilomyces farinosus, P. fumosoroseus and P. lilacinus, maintained in the culture collection of Embrapa-Centro Nacional de Pesquisa de Recursos Genéticos e Biotecnologia (Cenargen) and preserved by lyophilization and in liquid nitrogen, had their conidial viability assessed. Germination rates of 16- to 84-month-old cultures stored in liquid nitrogen decreased, on average, less than 13.3%. For 29- to 49-month-old cultures preserved by lyophilization, the viability loss ranged, on average, from 28.6 to 94.5%. The results demonstrated the efficiency of the tested methods, especially liquid nitrogen, in preserving the viability of entomopathogenic fungi.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.