215 resultados para Triplet Repeat Primed PCR (TP-PCR)
Resumo:
The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibitors imply that a detection or quantification limit, established for a given method, is restricted to a matrix used during validation and cannot be projected to any other matrix outside the scope of the method. In Brazil, sausage samples were the main class of processed products in which Roundup Ready® (RR) soybean residues were detected. Thus, the validation of methodologies for the detection and quantification of those residues is absolutely necessary. Sausage samples were submitted to two different methods of DNA extraction: modified Wizard and the CTAB method. The yield and quality were compared for both methods. DNA samples were analyzed by conventional and real-time PCR for the detection and quantification of Roundup Ready® soybean in the samples. At least 200 ng of total sausage DNA was necessary for a reliable quantification. Reactions containing DNA amounts below this value led to large variations on the expected GM percentage value. In conventional PCR, the detection limit varied from 1.0 to 500 ng, depending on the GM soybean content in the sample. The precision, performance, and linearity were relatively high indicating that the method used for analysis was satisfactory.
Resumo:
Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.
Resumo:
The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.
Resumo:
The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R²) demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct) values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.
Resumo:
To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.
Resumo:
The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.
Resumo:
The epidemiologic typing of bacterial pathogens can be applied to answer a number of different questions: in case of outbreak, what is the extent and mode of transmission of epidemic clone(s )? In case of long-term surveillance, what is the prevalence over time and the geographic spread of epidemic and endemic clones in the population? A number of molecular typing methods can be used to classify bacteria based on genomic diversity into groups of closely-related isolates (presumed to arise from a common ancestor in the same chain of transmission) and divergent, epidemiologically-unrelated isolates (arising from independent sources of infection). Ribotyping, IS-RFLP fingerprinting, macrorestriction analysis of chromosomal DNA and PCR-fingerprinting using arbitrary sequence or repeat element primers are useful methods for outbreak investigations and regional surveillance. Library typing systems based on multilocus sequence-based analysis and strain-specific probe hybridization schemes are in development for the international surveillance of major pathogens like Mycobacterium tuberculosis. Accurate epidemiological interpretation of data obtained with molecular typing systems still requires additional research on the evolution rate of polymorphic loci in bacterial pathogens.
Resumo:
Although human T-lymphotropic virus type I (HTLV-I) exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV), genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), using restricted fragment length polymorphism (RFLP) analysis of long terminal repeat (LTR) HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR) and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%), cosmopolitan C (7.1%) and cosmopolitan E (3.6%) subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.
Resumo:
Thirty-two Trypanosoma cruzi strains, isolated from chronic chagasic patients in the northwest of the state of Paraná (Brazil), were analyzed using molecular, biochemical and biological characteristics. Genotypic analysis using randomly amplified polymorphic DNA and simple sequence repeat-anchored polymerase chain reaction amplified profiles showed a large, genetically well-correlated group that contained the majority of the strains and a divergent group that included the PR-150 strain. For glycoconjugate composition, the PR-150 strain was different from the other strains considering the absence or presence of specific bands in aqueous or detergent phases. This strain was also totally different from the others in one out of the six parameters related to in vitro and in vivo biological behavior. We highlight the fact that the PR-150 was totally resistant to benznidazole. For the other biological parameters this strain was not totally distinct from the others, but it showed a peculiar behavior.
Resumo:
The aim of this study was to evaluate the use of one of the molecular typing methods such as PCR (polymerase chain reaction) following by RFLP (restriction fragment length polymorphism) analysis in the identification of Candida species and then to differentiate the identified azole susceptible and resistant Candida albicans strains by using AP-PCR (arbitrarily primed-polymerase chain reaction). The identification of Candida species by PCR and RFLP analysis was based on the size and primary structural variation of rDNA intergenic spacer regions (ITS). Forty-four clinical Candida isolates comprising 5 species were included to the study. The amplification products were digested individually with 3 different restriction enzymes: HaeIII, DdeI, and BfaI. All the isolates tested yielded the expected band patterns by PCR and RFLP analysis. The results obtained from this study demonstrate that Candida species can be differentiated as C. albicans and non-C. albicans strains only by using HaeIII restriction enzyme and BfaI maintains the differentiation of these non-C. albicans species. After identification Candida species with RFLP analysis, C. albicans strains were included to the AP-PCR test. By using AP-PCR, fluconazole susceptible and resistant strains were differentiated. Nine fluconazole susceptible and 24 fluconazole resistant C. albicans were included to the study. Fluconazole resistant strains had more bands when evaluating with the agarose gel electrophoresis but there were no specific discriminatory band patterns to warrant the differentiation of the resistance. The identification of Candida species with the amplification of intergenic spacer region and RFLP analysis is a practical, short, and a reliable method when comparing to the conventional time-consuming Candida species identification methods. The fluconazole susceptibility testing with AP-PCR seems to be a promising method but further studies must be performed for more specific results.
Resumo:
To assess reinfection of BALB/c mice with different Toxoplasma gondii strains, the animals were prime infected with the non-virulent D8 strain and challenged with virulent recombinant strains. Thirty days after challenge, brain cysts were obtained from surviving BALB/c mice and inoculated in Swiss mice to obtain tachyzoites for DNA extraction and PCR-RFLP analysis to distinguish the different T. gondii strains present in possible co-infections. Anti-Toxoplasma immune responses were evaluated in D8-primed BALB/c mice by detecting IFN-³ and IL-10 produced by T cells and measuring immunoglobulin levels in serum samples. PCR-RFLP demonstrated that BALB/c mice were reinfected with the EGS strain at 45 days post prime infection (dpi) and with the EGS and CH3 strains at 180 dpi. High levels of IFN-³ were detected after D8 infection, with no significant difference between 45 and 180-day intervals. However, higher IL-10 levels and higher plasmatic IgG1 and IgA were detected from samples obtained 180 days after infection. BALB/c mice were susceptible to reinfection with different recombinant T. gondii strains and this susceptibility correlated with enhancement of IL-10 production.
Resumo:
Small nucleolar RNAs (snoRNAs) are small non-coding RNAs that modify RNA molecules such as rRNA and snRNA by guiding 2'-O-ribose methylation (C/D box snoRNA family) and pseudouridylation reactions (H/ACA snoRNA family). H/ACA snoRNAs are also involved in trans-splicing in trypanosomatids. The aims of this work were to characterise the Cl gene cluster that encodes several snoRNAs in Trypanosoma rangeli and compare it with clusters from Trypanosoma cruzi, Trypanosoma brucei, Leishmania major, Leishmania infantum, Leishmania braziliensis and Leptomonas collosoma. The T. rangeli Cl gene cluster is an 801 base pair (bp) repeat sequence that encodes three C/D (Cl1, Cl2 and Cl4) and three H/ACA (Cl3, Cl5 and Cl6) snoRNAs. In contrast to T. brucei, the Cl3 and Cl5 homologues have not been annotated in the Leishmania or T. cruzi genome projects (http//:www.genedb.org). Of note, snoRNA transcribed regions have a high degree of sequence identity among all species and share gene synteny. Collectively, these findings suggest that the Cl cluster could constitute an interesting target for therapeutic (gene silencing) or diagnostic intervention strategies (PCR-derived tools).
Resumo:
CA88 is the first long nuclear repetitive DNA sequence identified in the blood fluke, Schistosoma mansoni. The assembled S. mansoni sequence, which contains the CA88 repeat, has 8,887 nucleotides and at least three repeat units of approximately 360 bp. In addition, CA88 also possesses an internal CA microsatellite, identified as SmBr18. Both PCR and BLAST analysis have been used to analyse and confirm the CA88 sequence in other S. mansoni sequences in the public database. PCR-acquired nuclear repetitive DNA sequence profiles from nine Schistosoma species were used to classify this organism into four genotypes. Included among the nine species analysed were five sequences of both African and Asian lineages that are known to infect humans. Within these genotypes, three of them refer to recognised species groups. A panel of four microsatellite loci, including SmBr18 and three previously published loci, has been used to characterise the nine Schistosoma species. Each species has been identified and classified based on its CA88 DNA fingerprint profile. Furthermore, microsatellite sequences and intra-specific variation have also been observed within the nine Schistosoma species sequences. Taken together, these results support the use of these markers in studying the population dynamics of Schistosoma isolates from endemic areas and also provide new methods for investigating the relationships between different populations of parasites. In addition, these data also indicate that Schistosoma magrebowiei is not a sister taxon to Schistosoma mattheei, prompting a new designation to a basal clade.