248 resultados para Urease test
Resumo:
To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.
Resumo:
A urease é a enzima que catalisa a hidrólise da ureia em dióxido de carbono e amônia. A distribuição da urease e os fatores que a influenciam têm importância relevante em vista do uso da ureia na agricultura. Nesse sentido, este estudo teve como objetivo definir a época adequada de coleta de solo, após adubação nitrogenada no feijoeiro comum, para medir a atividade de urease e seu perfil, considerando os efeitos residuais de diferentes plantas de cobertura e de sistema de preparo do solo. O experimento foi instalado em um Latossolo Vermelho distrófico e o feijoeiro, cultivar BRS Valente, semeado em junho de 2005, em sucessão a quatro plantas de cobertura de solo: capim-mombaça, milho em consórcio com braquiária, sorgo granífero e estilosantes, e dois sistemas de cultivo, direto e convencional. O delineamento experimental foi o de blocos ao acaso em parcelas divididas. As amostras de solo foram coletadas aos 3, 6, 8, 10 e 12 dias após a aplicação da ureia em cobertura no feijoeiro. A maior atividade de urease no solo ocorreu quando o feijoeiro foi cultivado após capim-mombaça, independentemente do preparo do solo e da época de sua avaliação. A mobilização do solo em cultivo no sistema plantio direto determinou menor atividade de urease, independentemente das espécies de cobertura e das épocas de sua avaliação. O pico de atividade de urease ocorreu entre o sétimo e o oitavo dia após a aplicação de ureia, independentemente das espécies de cobertura e do preparo do solo sob cultivo irrigado do feijoeiro comum.
Resumo:
Volatilização de NH3 é a principal reação que diminui a eficiência de utilização pelas plantas do N proveniente da ureia, quando ela é aplicada sobre a superfície do solo. A fim de minimizar essa perda, produtos têm sido misturados à ureia para inibir temporariamente a ação da urease. Este trabalho objetivou avaliar alternativas de aplicação de um fertilizante com inibidor de urease, visando a diminuir a volatilização de NH3 relativamente à ureia convencional, em algumas condições ambientais e de solo. Foram desenvolvidos quatro experimentos, todos em condições de laboratório, em 2007 e 2008, em Cambissolo Húmico. Os tratamentos variaram em cada estudo e incluíram combinações de níveis de pH do solo (natural; 5,5; 6,3; e 6,8), umidade do solo (5, 10 ou 20 % de água) e temperaturas ambientais (18 e 35 ºC), além de estados físicos (sólido ou líquido) e de métodos de aplicação dos fertilizantes (na superfície ou incorporado ao solo). As unidades experimentais foram constituídas por bandejas plásticas (23 x 51 x 17 cm) com 12 kg de solo, numa espessura de 15 cm, sobre as quais foram instaladas câmaras coletoras de NH3. A amônia volatilizada foi determinada em várias épocas, nos primeiros 28 dias após a aplicação dos fertilizantes. O pico de volatilização diária de NH3 ocorreu sempre na primeira semana depois da adição dos fertilizantes ao solo, e aconteceu dois a três dias mais tarde para a ureia com inibidor de urease, em relação à ureia convencional. A volatilização de NH3 nem sempre foi maior para a ureia convencional em comparação ao fertilizante contendo inibidor de urease, tampouco para o estado líquido em relação ao granulado. A volatilização de NH3 aumentou com a elevação do pH, da temperatura e da dose aplicada de N e foi menor nos extremos de umidade (solo com 5 % ou com 20 % de água). Para os fertilizantes aplicados sobre a superfície do solo, a taxa máxima de perda diária foi correspondente a 14 kg ha-1 de N, e a perda total acumulada variou de 2 a 50 % do N aplicado, dependendo principalmente do estado físico em que o fertilizante foi aplicado, da umidade do solo e da temperatura ambiente. A incorporação dos fertilizantes amídicos ao solo foi a maneira mais eficaz de minimizar as perdas de N por volatilização.
Resumo:
Enzymatic activity is an important property for soil quality evaluation. Two sequences of experiments were carried out in order to evaluate the enzymatic activity in a soil (Rhodic Eutrudox) amended with cattle manure, earthworm casts, or sewage sludges from the municipalities of Barueri and Franca. The activity of commercial enzymes was measured by microcalorimetry in the same soil samples after sterilization. In the first experiment, the enzyme activities of cellulase, protease, and urease were determined in the soil samples during a three month period. In the second sequence of experiments, the thermal effect of the commercial enzymes cellulase, protease, and urease on sterilized soil samples under the same tretaments was monitored for a period of 46 days. The experimental design was randomized and arranged as factorial scheme in five treatments x seven samplings with five replications. The treatment effects were statistically evaluated by one-way analysis of variance. Tukey´s test was used to compare means at p < 0.05. The presence of different sources of organic residues increased the enzymatic activity in the sampling period. Cattle manure induced the highest enzymatic activity, followed by municipal sewage sludge, whereas earthworm casts induced the lowest activity, but differed from control treatment. The thermal effect on the enzyme activity of commercial cellulase, protease, and urease showed a variety of time peaks. These values probably oscillated due to soil physical-chemical factors affecting the enzyme activity on the residues.
Resumo:
Nickel is a micronutrient involved in nitrogen metabolism and a constituent of the urease molecule. Plant growth and urease activity were evaluated in lettuce (Lactuca sativa L.) grown in soil-filled pots in a 2 x 8 factorial design with two nitrogen (N) sources and eight Ni rates, with five replications. Nitrogen was applied at 200 mg dm-3 (half the dose incorporated into the soil at seedling transplanting and half top-dressed later) using the sources NH4NO3 (AN) and CO(NH2)2 (Ur). The Ni treatments (0, 2, 4, 8, 12, 16, 24 and 32 mg dm-3) were applied as NiCl2. The shoot dry-matter yield, leaf urease activity, Ni levels in the lettuce leaves and Ni levels extracted from soil with Mehlich-3 (M-3) and DTPA were determined. In the plants supplied with AN, the shoot dry-matter yield was higher than in those supplied with Ur. There was no difference in shoot dry matter in response to soil-applied Ni. The leaf urease activity increased with Ni application, regardless of the N source. The extractions with M-3 and DTPA were efficient to evaluate Ni availability for lettuce in the Red-Yellow Latosol.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.
Resumo:
A avaliação do processamento radiográfico utilizando o "STEP test" ("sensitometric test for the evaluation of processing") tem como objetivo a identificação de desvios importantes no sistema processadora-químicos-filmes. Neste tipo de avaliação são estabelecidas as condições ideais para o processamento. Um filme padrão é revelado de acordo com as condições do fabricante, ou seja, com padrão igual a 100. O filme é exposto à luz de um sensitômetro calibrado e os valores dos degraus são avaliados com o uso de um densitômetro, sendo obtida sua curva característica (densidade óptica × degrau). O desvio porcentual máximo deve ser de 20% quando comparado com a curva padrão. Este método é útil na identificação de problemas no processamento radiográfico. Várias processadoras de hospitais públicos/universitários foram avaliadas empregando este método, e verificou-se que aproximadamente 33% das instalações apresentam condições inadequadas de processamento.
Resumo:
Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.
Resumo:
A spectrophotometric flow injection analysis (FIA) procedure employing natural urease enzyme source for the determination of urea in animal blood plasma was developed. Among leguminous plants used in the Brazilian agriculture, the Cajanus cajan specie was selected as urease source considering its efficiency and availability. A minicolumn was filled with leguminous fragments and coupled to the FIA manifold, where urea was on-line converted to ammonium ions and subsequently it was quantified by spectrophotometry. The system was employed to determine urea in animal plasma samples without any prior treatment. Accuracy was assessed by comparison results with those obtained employing the official procedure and no significant difference at 90 % confidence level was observed. Other profitable features such as an analytical throughput of 30 determinations per hour, a reagent consumption of 19.2 mg sodium salicylate, 0.5 mg sodium hipochloride and a relative standard deviation of 1.4 % (n= 12) were also obtained.
Resumo:
The void structure of zeolites MCM-22, MCM-36 and ITQ-2 were discussed on the bases of catalytic reaction tests. The hydromerization of n-decane on bifunctional Pt/Zeolite Catalysts have been used as model reactions. Beta and ZSM-5 zeolites were used for comparison. It is concluded that all materials show features of 10MR zeolites and have also pores bigger than 12MR in this order MCM-22
Resumo:
The aim of this work is to develop and validate a dissolution test for glibenclamide tablets. Optimal conditions to carry out the dissolution test are 500 mL of phosphate buffer at pH 8.0, paddles at 75 rpm stirring speed, time test set to 60 min and using equipment with six vessels. The derivative UV spectrophotometric method for determination of glibenclamide released was developed, validated and compared with the HPLC method. The UVDS method presents linearity (r² = 0.9999) in the concentration range of 5-14 µg/mL. Precision and recoveries were 0.42% and 100.25%, respectively. The method was applied to three products commercially available on the Brazilian market.
Resumo:
In this work we describe both a chromatographic purification procedure and a spot test for the enzyme peroxidase (POD: EC 1.11.1.7). The enzyme was obtained from crude extracts of sweet potatoes and the chromatographic enzyme purification procedure resulted in several fractions. Therefore a simple, fast and economic spot test for monitoring peroxidase during the purification procedure was developed. The spot test is based on the reaction of hydrogen peroxide and guaiacol, which is catalyzed by the presence of peroxidase yielding the colored tetraguaiacol.
Resumo:
A dissolution test for telithromycin tablets was validated and developed. In order to choose the most discriminatory one, the conditions to carry out are 900 mL of sodium phosphate buffer at pH 7.5, paddles at 50 rpm stirring speed, time test set to 60 min and using USP apparatus 2 with paddles. The UV spectrophotometric method for determination of telithromycin released was developed and validated. The method presents linearity (r = 1) in the concentration range of 20-60 µg/mL. Precision and recoveries were good, 100.62 and 97.06%, respectively. The method was successfully used for the dissolution test of telithromycin tablets.
Resumo:
This work describes the development and validation of a dissolution test for 50 mg losartan potassium capsules using HPLC and UV spectrophotometry. A 2(4) full factorial design was carried out to optimize dissolution conditions and potassium phosphate buffer, pH 6.8 as dissolution medium, basket as apparatus at the stirring speed of 50 rpm and time of 30 min were considered adequate. Both dissolution procedure and analytical methods were validated and a statistical analysis showed that there are no significant differences between HPLC and spectrophotometry. Since there is no official monograph, this dissolution test could be applied for quality control routine.