192 resultados para FORCED SWIMMING TEST


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An experimental test of rainfall as a control agent of Glycaspis brimblecombei Moore (Hemiptera, Psyllidae) on seedlings of Eucalyptus camaldulensis Dehn (Myrtaceae). Glycaspis brimblecombei is one the greatest threats to eucalyptus plantations in Brazil. The effects of rainfall to reduce the abundance of lerp of Glycaspis brimblecombei on experimentally infested seedlings of Eucalyptus camaldulensis were assessed. The number of lerps on the adaxial and abaxial surfaces of every leaf of 60 seedlings was recorded, before and after submission to the following treatments: "artificial rain", "leaf wetting" and control. A drastic reduction in lerp abundance per plant was observed after the treatments "leaf wetting" and artificial rain (F = 53.630; p < 0.001), whereas lerp abundance remained roughly constant in the control treatment along the experiment (F = 1.450; p = 0.232). At the end of the experiment, lerp abundance was significantly lower in both the "artificial rain" and "leaf wetting" than in the control treatment. Two days of rainfall simulation were sufficient to decrease more than 50% of the lerp population, with almost 100% of effectiveness after 5 days of experiment. Our results indicate that lerp solubilization and mechanical removal by water are potential tools to the population regulation of G. brimblecombei on E. camaldulensis seedlings.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A avaliação da qualidade do solo (QS) é importante estratégia no planejamento agrícola, possibilitando a identificação e o aprimoramento de sistemas de manejo com características de alta produtividade e de preservação ambiental. O presente estudo foi realizado em dois experimentos de longa duração (10 e 15 anos) conduzidos no Sul do Brasil e teve por objetivo avaliar o efeito de sistemas de manejo na QS, utilizando um kit de análise expedita de qualidade de solo (KQS), desenvolvido pelo Instituto de Qualidade do Solo-USDA-ARS. A eficiência desse kit foi avaliada pela comparação com os métodos tradicionais utilizados na ciência do solo. Nas duas áreas experimentais investigou-se um total de 12 tratamentos, os quais englobaram sistemas de preparo com diferentes intensidades de revolvimento do solo (preparo convencional, preparo reduzido e plantio direto) e sistemas de culturas com ampla faixa de adição de resíduos vegetais ao solo, além da aplicação de doses anuais de N-uréia, variando de 0 a 144 kg ha-1. Em cada base experimental uma área sob campo natural foi avaliada, servindo como referência da condição do solo na ausência de interferência antrópica. Como indicadores de QS, foram avaliados infiltração de água, respiração do solo, densidade do solo, teor de nitrato+nitrito (N-NO3- + N-NO2-), estabilidade de agregados em água e pH. De maneira geral, os coeficientes de correlação entre os métodos do KQS e os métodos tradicionais foram elevados, sendo o mais alto para o indicador pH (r = 0,98) e o menor para o indicador infiltração de água no solo (r = 0,42). Os tratamentos selecionados foram teoricamente ordenados em ordem crescente de QS, a qual foi reproduzida de forma eficiente pelo índice de estoque de carbono (IEC), calculado pela razão entre o estoque de C orgânico do solo, na camada de 0-5 cm, de cada tratamento e o estoque de C orgânico no solo sob campo natural. Os indicadores estabilidade de agregados, N-NO3- + N-NO2- e respiração do solo foram os mais eficientes em discriminar a QS. O KQS foi eficiente em avaliar a QS dos tratamentos nas duas áreas experimentais. Os níveis mais elevados de QS foram alcançados nos tratamentos com plantio direto e consórcio de gramíneas e leguminosas tropicais, devido à cobertura do solo e às elevadas adições de C e N via resíduos culturais.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to evaluate the effect of sustained swimming and dietary protein levels on growth and hematological responses of juvenile pacu (Piaractus mesopotamicus). A completely randomized design was used in a 3x2 factorial arrangement, with three levels of dietary protein (24, 28, and 32% crude protein), two rearing conditions (sustained swimming or motionless water), and 15 replicates. Fish were subjected to sustained swimming at the velocity of two body lengths per second (2 BL s-1), for 45 days. The level of dietary protein and the swimming conditions affected the performance, growth, and hematological profile of pacu. Swimming conditions influenced nutritional factors, increasing daily weight gain, specific growth rate, number of erythrocytes, mean corpuscular volume, and mean corpuscular hemoglobin. Fish under sustained swimming and fed with 24% crude protein showed better growth performance, with higher specific growth rate (4.11±0.88) and higher daily weight gain (2.19±0.47 g per day). Sustained swimming can increase the productive performance of pacu and simultaneously reduce dietary protein levels.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A avaliação do processamento radiográfico utilizando o "STEP test" ("sensitometric test for the evaluation of processing") tem como objetivo a identificação de desvios importantes no sistema processadora-químicos-filmes. Neste tipo de avaliação são estabelecidas as condições ideais para o processamento. Um filme padrão é revelado de acordo com as condições do fabricante, ou seja, com padrão igual a 100. O filme é exposto à luz de um sensitômetro calibrado e os valores dos degraus são avaliados com o uso de um densitômetro, sendo obtida sua curva característica (densidade óptica × degrau). O desvio porcentual máximo deve ser de 20% quando comparado com a curva padrão. Este método é útil na identificação de problemas no processamento radiográfico. Várias processadoras de hospitais públicos/universitários foram avaliadas empregando este método, e verificou-se que aproximadamente 33% das instalações apresentam condições inadequadas de processamento.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The void structure of zeolites MCM-22, MCM-36 and ITQ-2 were discussed on the bases of catalytic reaction tests. The hydromerization of n-decane on bifunctional Pt/Zeolite Catalysts have been used as model reactions. Beta and ZSM-5 zeolites were used for comparison. It is concluded that all materials show features of 10MR zeolites and have also pores bigger than 12MR in this order MCM-22

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this work is to develop and validate a dissolution test for glibenclamide tablets. Optimal conditions to carry out the dissolution test are 500 mL of phosphate buffer at pH 8.0, paddles at 75 rpm stirring speed, time test set to 60 min and using equipment with six vessels. The derivative UV spectrophotometric method for determination of glibenclamide released was developed, validated and compared with the HPLC method. The UVDS method presents linearity (r² = 0.9999) in the concentration range of 5-14 µg/mL. Precision and recoveries were 0.42% and 100.25%, respectively. The method was applied to three products commercially available on the Brazilian market.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work we describe both a chromatographic purification procedure and a spot test for the enzyme peroxidase (POD: EC 1.11.1.7). The enzyme was obtained from crude extracts of sweet potatoes and the chromatographic enzyme purification procedure resulted in several fractions. Therefore a simple, fast and economic spot test for monitoring peroxidase during the purification procedure was developed. The spot test is based on the reaction of hydrogen peroxide and guaiacol, which is catalyzed by the presence of peroxidase yielding the colored tetraguaiacol.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A dissolution test for telithromycin tablets was validated and developed. In order to choose the most discriminatory one, the conditions to carry out are 900 mL of sodium phosphate buffer at pH 7.5, paddles at 50 rpm stirring speed, time test set to 60 min and using USP apparatus 2 with paddles. The UV spectrophotometric method for determination of telithromycin released was developed and validated. The method presents linearity (r = 1) in the concentration range of 20-60 µg/mL. Precision and recoveries were good, 100.62 and 97.06%, respectively. The method was successfully used for the dissolution test of telithromycin tablets.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An analytical method has been developed and validated for the determination of an association of ampicillins in a lyophilized powder for injection by HPLC. The advantage of chromatographic method other than the microbiological one is that, it is possible to monitor precisely, out-of-specification results in quality control processes and also during stability studies, in which an association of ampicillins is present. The proposed HPLC method was developed by using forced degraded samples, in order to reach a selective analysis of ampicillins when in the presence of their degradation products. It was possible to detect benzatine and through indirect calculation, to determine the ampicillin sodium in the drug sample. The method showed to be selective, accurate, precise, robust and linear (from 45.92 to 36.04 μg mL-1 of total ampicillin and from 14.53 to 43.28 μg mL-1 of benzatine). The accuracy determined from recovery test, gave results in the range of 99.41% of total ampicillin to 100.31% of benzatine. Hence, it can be concluded that the proposed HPLC method is applicable for ampicillins determination.