259 resultados para Metilação de DNA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to evaluate, through a polymorphism in the ND5 gene of the bovine mitochondrial DNA, the frequency of Bos taurus indicus mtDNA individuals in a sample of Nellore purebred origin animals (n = 69) and crossbred animals originated from crosses of European sires and Nellore purebred origin females (n = 275). Only 2.26% (8/354) of the animals presented Bos taurus indicus mtDNA. The high frequency of Bos taurus taurus mtDNA in these animals can be a consequence of selection, once the animals studied are originated from selected lineages of high performance for meat production.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The biodiversity of soil communities remains very poorly known and understood. Soil biological sciences are strongly affected by the taxonomic crisis, and most groups of animals in that biota suffer from a strong taxonomic impediment. The objective of this work was to investigate how DNA barcoding - a novel method using a microgenomic tag for species identification and discrimination - permits better evaluation of the taxonomy of soil biota. A total of 1,152 barcode sequences were analyzed for two major groups of animals, collembolans and earthworms, which presented broad taxonomic and geographic sampling. Besides strongly reflecting the taxonomic impediment for both groups, with a large number of species-level divergent lineages remaining unnamed so far, the results also highlight a high level (15%) of cryptic diversity within known species of both earthworms and collembolans. These results are supportive of recent local studies using a similar approach. Within an impeded taxonomic system for soil animals, DNA-assisted identification tools can facilitate and improve biodiversity exploration and description. DNA-barcoding campaigns are rapidly developing in soil animals and the community of soil biologists is urged to embrace these methods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A identificação e caracterização da diversidade genética de plantas por meio de técnicas moleculares envolvem a avaliação de vários indivíduos, necessitando-se, portanto, de métodos rápidos e precisos de extração do DNA. O co-isolamento de polissacarídeos, fenóis e compostos secundários é o principal problema encontrado no isolamento e purificação de DNA vegetal. Folhas das diversas espécies de Passiflora possuem níveis variados desses compostos que podem comprometer este procedimento. O presente estudo foi realizado com o objetivo de avaliar a qualidade e quantidade de DNA de folhas de variedades de Passiflora spp., utilizando-se de três métodos de extração. Os três métodos forneceram DNA em qualidade e quantidade suficientes para a realização da técnica PCR-RAPD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Os marcadores microssatélites são ferramentas úteis em diversas análises genéticas em plantas. No caso do mamoeiro (Carica papaya L.), poucos locos de microssatélites foram descritos até o momento. Assim, o objetivo deste trabalho foi explorar a base de dados do GenBank / NCBI (National Center of Biotechnoloy Information) à procura de microssatélites de mamoeiro, visando a seu futuro uso em estudos genéticos e moleculares aplicados ao melhoramento genético. As seqüências foram obtidas no GenBank / NCBI, no formato FASTA, e analisadas para a presença de microssatélites com um mínimo de 20; 7 e 5 repetições dos motivos de mono-, di- e trinucleotídeos, respectivamente, e acima de 4 repetições para tetra- e pentanucleotídeos. Seqüências com mais de 90% de similaridade foram consideradas redundantes e, portanto, eliminadas das análises. Foram analisadas 44.591 seqüências, das quais 3.180 foram não-redundantes e apresentaram 3.947 microssatélites. Desse total, 3.587 foram classificados como microssatélites perfeitos, 8 imperfeitos, 65 interrompidos, 239 compostos-perfeitos, 8 compostos-imperfeitos e 40 compostos-interrompidos. As repetições de di- e trinucleotídeos representaram 65,7 e 14,4% do total de seqüências analisadas, respectivamente. Somente os motivos do tipo AT/TA representaram 44,1% dos microssatélites encontrados. Os motivos mais comuns de tri-, tetra- e pentanucleotídeos foram AAT, AATT e TTTAA, respectivamente. Observou-se que, nas seqüências disponíveis, o genoma do mamoeiro apresenta, em média, um microssatélite a cada 5,65 kb.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

RESUMO A determinação do nível de ploidia é muito importante, principalmente em programas de melhoramento genético que envolvem poliploides, a fim de possibilitar a escolha adequada dos materiais vegetais com os quais se deseja trabalhar. A relação entre o conteúdo de DNA de acessos de bananeira e sua ploidia ainda permanece controversa na literatura; assim, o presente trabalho teve como objetivo avaliar o conteúdo de DNA de acessos de bananeira com diferentes níveis de ploidia. Foram avaliados sete acessos tetraploides, quatro triploides e quatro diploides. A determinação do conteúdo foi realizada pela técnica de citometria de fluxo. Foram trituradas entre 50-60 mg de folhas frescas, juntamente com o padrão interno (Pisum sativum) no tampão LB01, e, posteriormente, as amostras foram filtradas em gaze e filtro de 50 µm. Adicionaram-se 5 µL de RNase e 25 µL de iodeto de propídeo. Para cada amostra, foram analisados 10 mil núcleos, com três repetições. Os resultados obtidos para o conteúdo de DNA permitiram estimar o tamanho dos genomas A e B, sendo o primeiro cerca de 14% maior que o segundo. Os resultados apresentaram clara relação entre o conteúdo de DNA e o nível de ploidia dos materiais. O contéudo de DNA apresentou aumento médio de 30% nas cultivares diploides em relação às cultivares triploides avaliadas e de 25% nas cultivares triploides em relação às cultivares tetraploides. Apesar da diferença nos tamanhos dos genomas A e B, contribuições distintas desses dois genomas não foram diretamente relacionadas com alterações no conteúdo do DNA de cultivares tetraploides.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One old dream of the chemist in the field of the drug research is to create molecules capable of reaching their target with the precision of a missile. To accomplish it these molecules must have the propriety of distinguishing qualitative differences between healthy and diseased cells. A therapy based on this principle, able of eradicating specifically defective cells, or cells affected by a pathogen has an enormous advantage with the regard to the classical approach in which the cytotoxic drugs merely exploit quantitative biochemical and kinetic differences between abnormal and normal cells. We present in this article a review on the chemical synthesis of analogues of desoxyribonucleotides and on results obtained on the specific and irreversible inhibition of undesired genetic expression using the antisense principle.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The first studies about DNA electrochemistry appeared at the end of the fifties. The voltammetric techniques became important tool for the DNA conformational analysis, producing evidences about DNA double helix polimorphism. The new techniques based on electrodes modification with nucleic acid enlarged the use of the electrochemical methods on the DNA research. DNA electrochemical biosensors are able to detect specific sequences of DNA bases, becoming important alternative for the diagnosis of disease, as well as in the carcinogenic species determination. Besides, the use of DNA biosensors in the mechanism study of biological drug actions can be useful for drug design.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

5-Aminolevulinic acid (ALA) is a heme precursor accumulated in acute intermittent porphyria (AIP), which might be associated with hepatocellular carcinoma (HCC) in symptomatic patients. Under metal catalyzed oxidation, ALA and its cyclic dimerization product, 3,6-dihydropyrazine-2,5-dipropanoic acid, produce reactive oxygen species that damage plasmid and calf thymus DNA bases, increase the steady state level of 8-oxo-7,8-dihydro-2´-deoxyguanosine in liver DNA and promote mitochondrial DNA damage. The final product of ALA, 4,5-dioxovaleric acid (DOVA), is able to alkylate guanine moieties, producing adducts. ALA and DOVA are mutagenic in bacteria. This review shows an up-to-date literature data that reinforce the hypothesis that the DNA damage induced by ALA may be associated with the development of HCC in AIP patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A number of ring-extended DNA adducts resulting from reaction of alpha,beta-unsaturated aldehydes, or their epoxides, with DNA bases have been characterized in recent years. These adducts can lead to miscoding during DNA replication which, if not repaired, result in mutations that can contribute to cancer development. Recently, the use of ultrasensitive methods allowed the detection of background levels of etheno DNA adducts in tissues of untreated animals and humans suggesting the existence of endogenous sources of reactive intermediates. In this review, we briefly summarize the recent advances in the chemistry of these DNA lesions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The bioactive compound trans-3'-methylsulphonylallyl trans-cinnamate (1) along with the inactives iryelliptin (2) and (7R,8S,1'S)-delta8'-3',5'-dimethoxy-1',4'-dihydro-4'-oxo-7.0.2',8.1'-neolignan (3) were isolated from the leaves of Cinnamomum australe. The structures of these compounds were assigned by analysis of 1D and 2D NMR data and comparison with data registered in the literature for these compounds. The DNA-damaging activity of 1 is being described for the first time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chemotherapy agents against cancer may be classified as "cell cycle-specific" or "cell cycle-nonspecific". Nevertheless, several of them have their biological activity related to any kind of action on DNA such as: antimetabolic agents (DNA synthesis inhibition), inherently reactive agents (DNA alkylating electrophilic traps for macromolecular nucleophiles from DNA through inter-strand cross-linking - ISC - alkylation) and intercalating agents (drug-DNA interactions inherent to the binding made due to the agent penetration in to the minor groove of the double helix). The earliest and perhaps most extensively studied and most heavily employed clinical anticancer agents in use today are the DNA inter-strand cross-linking agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The oxidation of sulfite catalyzed by transition metal ions produces reactive oxysulfur species that can damage plasmid and isolated DNA in vitro. Among the four DNA bases, guanine is the most sensitive to one-electron oxidation promoted by the species formed in the autoxidation of sulfite (HSO5-, HO•, SO3•-, SO4•- and SO5•-) due to its low reduction potential and ability to bind transition metal ions capable to catalyze oxidative processes. Some oxidative DNA lesions are promutagenic and oxidative DNA damage is proposed to play a crucial role in certain human pathologies, including cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate oxidative lesions and strand breaks induction by singlet molecular oxygen (¹O2), supercoiled-DNA plasmid was treated with thermo-dissociated DHPNO2 and photoactivated-methylene blue. DNA lesions were detected by Fpg that cleaves DNA at certain oxidized bases, and T4-endoV, which cleaves DNA at cyclobutane pyrimidine dimers and apurinic/apyrimidinic (AP) sites. These cleavages form open relaxed-DNA structures, which are discriminated from supercoiled-DNA. DHPNO2 or photoactivated-MB treatments result in similar plasmid damage profile: low number of single-strand breaks or AP-sites and high frequency of Fpg-sensitive sites; confirming that base oxidation is the main product for both reactions and that ¹O2 might be the most likely intermediate that reacts with DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The electrochemical behavior of the interaction of amodiaquine with DNA on a carbon paste electrode was studied using voltametric techniques. In an acid medium, an electroactive adduct is formed when amodiaquine interacts with DNA. The anodic peak is dependent on pH, scan rate and the concentration of the pharmaceutical. Adduct formation is irreversible in nature, and preferentially occurs by interaction of the amodiaquine with the guanine group. Theoretical calculations for optimization of geometry, and DFT analyses and on the electrostatic potential map (EPM), were used in the investigation of adduct formation between amodiaquine and DNA.