Development of blast resistant somaclones of the upland rice cultivar araguaia

The degree of blast resistance of upland rice (Oryza sativa L.) cultivar Araguaia has decreased over time causing significant yield losses. The major objective of this study was to obtain blast (Pyricularia grisea) resistant somaclones, adapting greenhouse and field selection procedures. Rice blast resistance and agronomic traits were assessed in R2 to R6 generations derived from regenerant plants (R1) from immature panicles of Araguaia. The evaluation and selection procedures include testing of early segregating populations and fixed lines in the advanced generations, under natural field conditions, and artificial inoculations in the greenhouse, with prevalent races IB-1 and IB-9 of P. grisea. Somaclones with both vertical resistance and slow blasting resistance were obtained. Twenty of 31 somaclones developed with a high degree of vertical resistance and fan shaped plant type maintained resistance in field and blast nursery tests in the R6 generation. Greenhouse selection with two specific physiologic races yielded 44 somaclones with slow blasting resistance, similar plant type and yield potential as that of Araguaia.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Variation in virulence in the rice blast fungus Magnaporthe grisea in São Paulo State

Resistant varieties have been the preferred means to control Magnaporthe grisea, the causal organism of the rice blast disease. The objective of this study was to examine the degree of diversity of the pathogen in different rice growing regions of São Paulo State, Brazil. Blast samples collected from rice varieties in three different regions (Tremembé, Mococa and José Bonifácio) were analyzed for race structure employing the Japanese rice differentials. The highest degree of virulence diversity was observed in Tremembé with 22 different races in three different varieties. Furthermore, no resistance gene in the Japanese differentials was effective to all isolates of M. grisea from São Paulo State.

Cultivar response to fungicide application in relation to rice blast control, productivity and sustainability

Four field trials were conducted, from 1995 to 1997, with the objective of studying the response of four upland cultivars to foliar fungicide application in relation to panicle blast control, grain yield and sustainability. Differential disease control and yield response of cultivars to fungicide treatment were obtained. Losses in grain yield of cultivars IAC 202, Caiapó, Rio Paranaíba and Araguaia due to panicle blast were 44.8%, 27.4%, 24.4% and 18.2%, respectively. Two applications of tricyclazole or benomyl controlled panicle blast, as indicated by lower values of disease progress curve and relative panicle blast severity, and increased grain yield of the cultivar IAC 202. The losses in 100 panicle grain weight and grain yield were significantly reduced by 22.3% and 25.1% in IAC 202 and 23.6% and 20.5% in Caiapó, respectively, with two sprays of tricyclazole. Sustainable value index for yield was maximum with two applications of tricyclazole (0.59), followed by one application at booting (0.46) and at heading (0.40) in cultivar IAC 202. Results showed no yield response of the cultivars Rio Paranaíba and Araguaia to fungicide applications for panicle blast control.

Resistance spectra of six elite breeding lines of upland rice to Pyricularia grisea

The objective of this work was to evaluate the resistance spectra of six elite breeding lines of rice, developed for improved yield and grain quality, in inoculation tests in the greenhouse and in the field. Forty-six isolates of Pyricularia grisea collected from the cultivar Primavera, 31 from the cultivar Maravilha and 19 from six elite breeding lines, totaling 96 were utilized for inoculations. Out of 11 international and 15 Brazilian pathotypes, IC-1, IB-9, and BD-16, respectively, were identified as most frequent isolates collected from the cultivar Primavera. The isolates retrieved from Maravilha belong to four international and 11 Brazilian pathotypes, the predominant ones being IB-9 and IB-49 and BB-1 and BB-21, respectively. Lines CNAs 8711 and CNAs 8983 showed resistant reaction to all test isolates from Maravilha, while CNAs 8983 was susceptible to three isolates of Primavera pertaining to the pathotype IC-1. A majority of isolates exhibiting compatible reaction to Primavera were incompatible to Maravilha and vice-versa.Field assessment of rice blast utilizing the area under disease progress curve as a criterion for measuring disease severity showed significant differences among the six breeding lines. The isolates of P. grisea exhibiting differential reaction on breeding lines can be utilized in pyramiding resistance genes in new upland rice cultivars.

Conductivity test in seeds of different passion flower species

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.

Characterization of rue extract and its potential for controlling rice blast

Abstract: The objective of this work was to purify and standardize the rue (Ruta graveolens) extract and evaluate its effect on Magnaporthe oryzae as an alternative to the integrated management of rice blast. The drug was characterized, the liquid extract was obtained, and the methodology for quantifying the standard markers psoralen and bergapten was validated. Rue extract and the markers, solely or in combination, were assayed in vitro, as well as in greenhouse conditions, for their ability to suppress leaf blast, by the evaluation of mycelial growth, conidial germination, and appressorium formation. Rue extract inhibited M. oryzae mycelial growth (100%), conidial germination (LD50=0.237 mg), and the appressorium formation (LD50=0.121 mg); besides, the extract reduced leaf blast severity by 80.84%. Fluorescence microscopy showed that rue extract did not damage M. oryzae cell wall and plasma membrane, indicating another mode of action. Rue extract has a great potential for controlling rice leaf blast.

Avaliação da velocidade de processamento de processadoras automáticas ultilizado o método "STEP test"

A avaliação do processamento radiográfico utilizando o "STEP test" ("sensitometric test for the evaluation of processing") tem como objetivo a identificação de desvios importantes no sistema processadora-químicos-filmes. Neste tipo de avaliação são estabelecidas as condições ideais para o processamento. Um filme padrão é revelado de acordo com as condições do fabricante, ou seja, com padrão igual a 100. O filme é exposto à luz de um sensitômetro calibrado e os valores dos degraus são avaliados com o uso de um densitômetro, sendo obtida sua curva característica (densidade óptica × degrau). O desvio porcentual máximo deve ser de 20% quando comparado com a curva padrão. Este método é útil na identificação de problemas no processamento radiográfico. Várias processadoras de hospitais públicos/universitários foram avaliadas empregando este método, e verificou-se que aproximadamente 33% das instalações apresentam condições inadequadas de processamento.

Dose calibrator linearity test: 99mTc versus 18F radioisotopes

Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.

Evaluación de la estructura porosa de los materiales MCM-22, MCM-36 e ITQ-2 empleando el test catalitico del n-decano

The void structure of zeolites MCM-22, MCM-36 and ITQ-2 were discussed on the bases of catalytic reaction tests. The hydromerization of n-decane on bifunctional Pt/Zeolite Catalysts have been used as model reactions. Beta and ZSM-5 zeolites were used for comparison. It is concluded that all materials show features of 10MR zeolites and have also pores bigger than 12MR in this order MCM-22

Dissolution test for glibenclamide tablets

The aim of this work is to develop and validate a dissolution test for glibenclamide tablets. Optimal conditions to carry out the dissolution test are 500 mL of phosphate buffer at pH 8.0, paddles at 75 rpm stirring speed, time test set to 60 min and using equipment with six vessels. The derivative UV spectrophotometric method for determination of glibenclamide released was developed, validated and compared with the HPLC method. The UVDS method presents linearity (r² = 0.9999) in the concentration range of 5-14 µg/mL. Precision and recoveries were 0.42% and 100.25%, respectively. The method was applied to three products commercially available on the Brazilian market.

Desenvolvimento de um spot test para o monitoramento da atividade da peroxidase em um procedimento de purificação

In this work we describe both a chromatographic purification procedure and a spot test for the enzyme peroxidase (POD: EC 1.11.1.7). The enzyme was obtained from crude extracts of sweet potatoes and the chromatographic enzyme purification procedure resulted in several fractions. Therefore a simple, fast and economic spot test for monitoring peroxidase during the purification procedure was developed. The spot test is based on the reaction of hydrogen peroxide and guaiacol, which is catalyzed by the presence of peroxidase yielding the colored tetraguaiacol.

Development and validation of a dissolution test for telithromycin in coated tablets

A dissolution test for telithromycin tablets was validated and developed. In order to choose the most discriminatory one, the conditions to carry out are 900 mL of sodium phosphate buffer at pH 7.5, paddles at 50 rpm stirring speed, time test set to 60 min and using USP apparatus 2 with paddles. The UV spectrophotometric method for determination of telithromycin released was developed and validated. The method presents linearity (r = 1) in the concentration range of 20-60 µg/mL. Precision and recoveries were good, 100.62 and 97.06%, respectively. The method was successfully used for the dissolution test of telithromycin tablets.

Losartan potassium dissolution test for drug release evaluation in pharmaceutical capsules using HPLC and UV spectrophotometry

This work describes the development and validation of a dissolution test for 50 mg losartan potassium capsules using HPLC and UV spectrophotometry. A 2(4) full factorial design was carried out to optimize dissolution conditions and potassium phosphate buffer, pH 6.8 as dissolution medium, basket as apparatus at the stirring speed of 50 rpm and time of 30 min were considered adequate. Both dissolution procedure and analytical methods were validated and a statistical analysis showed that there are no significant differences between HPLC and spectrophotometry. Since there is no official monograph, this dissolution test could be applied for quality control routine.

Development of new dissolution test and HPLC-RP method for anti-parasitic ornidazole coated tablets

This work aimed the development and validation of a new dissolution test for ornidazole coated tablets. The dissolution conditions were determined after testing Sink conditions, dissolution medium, apparatus, stirring speed, 24 h stability and medium filtration influence. The best conditions were paddle at a stirring speed of 75 rpm and 900 mL of 0.1 M HCl. A new HPLC quantification method was developed and validated. The dissolution test and quantification method showed to be adequate for their purposes and could be applied for quality control of ornidazole coated tablets, since there is no official monograph.