Structural quality of soils cultivated with coffee and pasture in an environmental protection area

Studies of soils in Environmental Protection Areas (EPAs) are of great importance, because they are an essential component of ecosystems, directly interfering in environmental sustainability. The objective of this study was to evaluate the structural quality of soil cultivated with coffee and used as pasture in the Capituva's River microbasin, which is located in the Environmental Protection Area in Coqueiral, south of the state of Minas Gerais. Uniaxial compression test (preconsolidation test) and soil resistance to penetration were used. Undisturbed samples were taken from the surface layer (0-5 cm) of the soils in the area: a typic dystrophic Red Latosol (LVd - Oxisol), a typic eutrophic Red Argisol (PVe - Ultisol), and a typic dystrophic Haplic Cambisol (CXbd - Inceptisol). A significant linear positive correlation was observed between the results of the preconsolidation test and soil resistance to penetration. Load bearing capacity of soil could be estimated accordingly by means of penetration resistance for LVd, PVe, and CXbd. Cambisol - CXbd showed lower loading support capacity and resistance to penetration than LVd and PVe, due to the better crop management in this soil that resulted in higher physical quality which accounts for higher production and environmental sustainability.

Pedotransfer functions to estimate proctor test parameters under different tillage systems

The Proctor test is time-consuming and requires sampling of several kilograms of soil. Proctor test parameters were predicted in Mollisols, Entisols and Vertisols of the Pampean region of Argentina under different management systems. They were estimated from a minimum number of readily available soil properties (soil texture, total organic C) and management (training data set; n = 73). The results were used to generate a soil compaction susceptibility model, which was subsequently validated using a second group of independent data (test data set; n = 24). Soil maximum bulk density was estimated as follows: Maximum bulk density (Mg m-3) = 1.4756 - 0.00599 total organic C (g kg-1) + 0.0000275 sand (g kg-1) + 0.0539 management. Management was equal to 0 for uncropped and untilled soils and 1 for conventionally tilled soils. The established models predicted the Proctor test parameters reasonably well, based on readily available soil properties. Tillage systems induced changes in the maximum bulk density regardless of total organic matter content or soil texture. The lower maximum apparent bulk density values under no-tillage require a revision of the relative compaction thresholds for different no-tillage crops.

Portable penetrometer for agricultural soil: sensitivity test to identify critical compaction depth

To express the negative effects of soil compaction, some researchers use critical values for soil mechanical strength that severely impair plant growth. The aim of this study was to identify this critical compaction depth, to test the functionality of a new, portable penetrometer developed from a spring dynamometer, and compare it to an electronic penetrometer traditionally used in compaction studies of agricultural soils. Three soils with distinct texture were conventionally tilled using a disk plow, and cultivated with different plant species. The critical soil resistance defined to establish critical compaction depth was equal to 1.5 MPa. The results of the new equipment were similar to the electronic penetrometer, indicating its viability as a tool for assessing the soil physical conditions for plant growth.

Structural sustainability of cambisol under different land use system

Incongruous management techniques have been associated with some significant loss of agricultural land to degradation in many parts of the world. Land degradation results in the alteration of physical, chemical and biological properties of the soil, thereby posing a serious threat to sustainable agricultural development. In this study, our objective is to evaluate the changes in a Cambisol structure under six land use systems using the load bearing capacity model. Sampling was conducted in Amazonas Region, Brazil, in the following land use: a) young secondary forest; b) old secondary forest; c) forest; d) pasture; e) cropping, and f) agroforestry. To obtain the load bearing capacity models the undisturbed soil samples were collected in those land use systems and subjected to the uniaxial compression test. These models were used to evaluate which land use system preserved or degraded the Cambisol structure. The results of the bulk density and total porosity of the soil samples were not adequate to quantify structural degradation in Cambisol. Using the forest topsoil level (0-0.03 m) as a reference, it was observed that pasture land use system was most severe in the degradation of the soil structure while the structure were most preserved under old secondary forest, cropping system and forest. At the subsoil level (0.10-0.13 m depth), the soil structure was most degraded in the cropping land use system while it was most preserved in young secondary forest and pasture. At the 0.20-0.23 m depth, soil structure degradation was most severe in the old secondary forest system and well preserved in young secondary forest, cropping and agroforestry.

MODELING OF SOIL LOAD-BEARING CAPACITY AS A FUNCTION OF SOIL MECHANICAL RESISTANCE TO PENETRATION

Estimation of soil load-bearing capacity from mathematical models that relate preconsolidation pressure (σp) to mechanical resistance to penetration (PR) and gravimetric soil water content (U) is important for defining strategies to prevent compaction of agricultural soils. Our objective was therefore to model the σp and compression index (CI) according to the PR (with an impact penetrometer in the field and a static penetrometer inserted at a constant rate in the laboratory) and U in a Rhodic Eutrudox. The experiment consisted of six treatments: no-tillage system (NT); NT with chiseling; and NT with additional compaction by combine traffic (passing 4, 8, 10, and 20 times). Soil bulk density, total porosity, PR (in field and laboratory measurements), U, σp, and CI values were determined in the 5.5-10.5 cm and 13.5-18.5 cm layers. Preconsolidation pressure (σp) and CI were modeled according to PR in different U. The σp increased and the CI decreased linearly with increases in the PR values. The correlations between σp and PR and PR and CI are influenced by U. From these correlations, the soil load-bearing capacity and compaction susceptibility can be estimated by PR readings evaluated in different U.

Least Limiting Water Range and Load Bearing Capacity of Soil under Types of Tractor-Trailers for Mechanical Harvesting of Green Sugarcane

ABSTRACT The expansion of the sugarcane industry in Brazil has intensified the mechanization of agriculture and caused effects on the soil physical quality. The purpose of this study was to evaluate the limiting water range and soil bearing capacity of a Latossolo Vermelho distroférrico típico (Rhodic Hapludox) under the influence of different tractor-trailers used in mechanical sugarcane harvesting. The experiment was arranged in a randomized block design with five replications. The treatments consisted of green sugarcane harvesting with: harvester without trailer (T1); harvester with two trailers with a capacity of 10 Mg each (T2); harvester with trailer with a capacity of 20 Mg (T3) and harvester and truck with trailer with a capacity of 20 Mg (10 Mg per compartment) (T4). The least limiting water range and soil bearing capacity were evaluated. The transport equipment to remove the harvested sugarcane from the field (trailer) at harvest decreased the least limiting water range, reducing the structural soil quality. The truck trailer caused the greatest impact on the soil physical properties studied. The soil load bearing capacity was unaffected by the treatments, since the pressure of the harvester (T1) exceeded the pre-consolidation pressure of the soil.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Conductivity test in seeds of different passion flower species

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.

Avaliação da velocidade de processamento de processadoras automáticas ultilizado o método "STEP test"

A avaliação do processamento radiográfico utilizando o "STEP test" ("sensitometric test for the evaluation of processing") tem como objetivo a identificação de desvios importantes no sistema processadora-químicos-filmes. Neste tipo de avaliação são estabelecidas as condições ideais para o processamento. Um filme padrão é revelado de acordo com as condições do fabricante, ou seja, com padrão igual a 100. O filme é exposto à luz de um sensitômetro calibrado e os valores dos degraus são avaliados com o uso de um densitômetro, sendo obtida sua curva característica (densidade óptica × degrau). O desvio porcentual máximo deve ser de 20% quando comparado com a curva padrão. Este método é útil na identificação de problemas no processamento radiográfico. Várias processadoras de hospitais públicos/universitários foram avaliadas empregando este método, e verificou-se que aproximadamente 33% das instalações apresentam condições inadequadas de processamento.

Dose calibrator linearity test: 99mTc versus 18F radioisotopes

Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.

Evaluación de la estructura porosa de los materiales MCM-22, MCM-36 e ITQ-2 empleando el test catalitico del n-decano

The void structure of zeolites MCM-22, MCM-36 and ITQ-2 were discussed on the bases of catalytic reaction tests. The hydromerization of n-decane on bifunctional Pt/Zeolite Catalysts have been used as model reactions. Beta and ZSM-5 zeolites were used for comparison. It is concluded that all materials show features of 10MR zeolites and have also pores bigger than 12MR in this order MCM-22

Dissolution test for glibenclamide tablets

The aim of this work is to develop and validate a dissolution test for glibenclamide tablets. Optimal conditions to carry out the dissolution test are 500 mL of phosphate buffer at pH 8.0, paddles at 75 rpm stirring speed, time test set to 60 min and using equipment with six vessels. The derivative UV spectrophotometric method for determination of glibenclamide released was developed, validated and compared with the HPLC method. The UVDS method presents linearity (r² = 0.9999) in the concentration range of 5-14 µg/mL. Precision and recoveries were 0.42% and 100.25%, respectively. The method was applied to three products commercially available on the Brazilian market.

Desenvolvimento de um spot test para o monitoramento da atividade da peroxidase em um procedimento de purificação

In this work we describe both a chromatographic purification procedure and a spot test for the enzyme peroxidase (POD: EC 1.11.1.7). The enzyme was obtained from crude extracts of sweet potatoes and the chromatographic enzyme purification procedure resulted in several fractions. Therefore a simple, fast and economic spot test for monitoring peroxidase during the purification procedure was developed. The spot test is based on the reaction of hydrogen peroxide and guaiacol, which is catalyzed by the presence of peroxidase yielding the colored tetraguaiacol.

Development and validation of a dissolution test for telithromycin in coated tablets

A dissolution test for telithromycin tablets was validated and developed. In order to choose the most discriminatory one, the conditions to carry out are 900 mL of sodium phosphate buffer at pH 7.5, paddles at 50 rpm stirring speed, time test set to 60 min and using USP apparatus 2 with paddles. The UV spectrophotometric method for determination of telithromycin released was developed and validated. The method presents linearity (r = 1) in the concentration range of 20-60 µg/mL. Precision and recoveries were good, 100.62 and 97.06%, respectively. The method was successfully used for the dissolution test of telithromycin tablets.

Losartan potassium dissolution test for drug release evaluation in pharmaceutical capsules using HPLC and UV spectrophotometry

This work describes the development and validation of a dissolution test for 50 mg losartan potassium capsules using HPLC and UV spectrophotometry. A 2(4) full factorial design was carried out to optimize dissolution conditions and potassium phosphate buffer, pH 6.8 as dissolution medium, basket as apparatus at the stirring speed of 50 rpm and time of 30 min were considered adequate. Both dissolution procedure and analytical methods were validated and a statistical analysis showed that there are no significant differences between HPLC and spectrophotometry. Since there is no official monograph, this dissolution test could be applied for quality control routine.