84 resultados para GENOMIC DNA


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were adequate for DNA extraction of this stingless bee, both for adults and larvae

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil) from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica). The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

We describe a case of human T-lymphotropic virus type I associated myelopathy in a 50-year old woman in Nigeria. The patient presented with progressive loss of tone to the two lower limbs and later inability to walk. The HTLV-I antibody presence in the plasma collected from the patient was repeatedly detected by enzyme immunoassays (Abbott HTLV-I EIA and Coulter SELECT-HTLV I/II) and confirmed by Western blot technique. In addition, HTLV-I DNA was amplified from the genomic DNA isolated from the peripheral blood mononuclear cells of the patient by the polymerase chain reaction technique. This finding is significant being the first report of association of HTLV-I with myelopathy in Nigeria.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Molecular characterization of Cryptosporidium spp.oocysts in clinical samples is useful for public health since it allows the study of sources of contamination as well as the transmission in different geographical regions. Although widely used in developed countries, in Brazil it is restricted to academic studies, mostly using commercial kits for the extraction of genomic DNA, or in collaboration with external reference centers, rendering the method expensive and limited. The study proposes the application of the modifications recently introduced in the method improving feasibility with lower cost. This method was efficient for clinical samples preserved at -20 °C for up to six years and the low number of oocysts may be overcomed by repetitions of extraction.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

SUMMARYThe use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Genomic DNA fragments from males of Psychodopygus wellcomei were isolated and shown to be useful as sensitive diagnostic probles for positively separting individuals of this species from those of Ps. complexus. These two members of the Ps. squamiventris series are found sympatrically in foci of cutaneous leishmaniasis in the hill forests of southern Pará State. Of the two species, only Ps. welcomei is thought to be an important vector of Leishmania braziliensis sensu stricto, buth this is based on circumstantial evidence because of the difficulties of identifying female sandflies wothin the series. The diagnostic probes were isolated from a library of Ps. wellcomei built by ligationg short fragments of Sau 3A-resistricted, genomic DNA into the plasmid vector PUC 18. Differential screening of 1316 library clones with total genomic DNA of Ps. Wellcomei and Ps. complexus identified 5 recombinants, with cross-hybridizing inserts of repetitive DNA, that showed strong specificity for Ps. wellcomei. As little as 0.4% of the DNA extracted from an individual sandfly (=ca. 0.5 namograms) was specifically detected. The diagnostic probes were used to identify as Ps. wellcomei a wild-caught female sandfly found infected with L. braziliensis s.s., providing only the second positive association between these two species.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). The efficiency was 0.99 and the correlation coefficient (R²) was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC). The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden) in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The aim of the present study was to assess the occurrence of antibodies to Toxoplasma gondii and to detect genomic DNA of the parasite in the reproductive organs, fetuses and fetal membranes of sheep in slaughterhouses in the state of Pernambuco, Brazil. The Indirect Immunofluorescence technique (IFA) was used for screening. The Polymerase Chain Reaction (PCR) was used to detect DNA of T. gondii in the animals that were positive in the serology. In the serology, 13/50 samples were positive and genomic DNA of T. gondii was detected in one uterus, tube, ovary, placenta and fetus (heart, brain and umbilical cord) sample from a sheep that was positive in the serology. The present study provides evidence of the occurrence of T. gondii DNA in the organs of the reproductive system, placenta and fetus of a naturally infected sheep.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA), developed by Heath et al. [Nucleic Acids Research (1993) 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel) specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The objective of the present study was to develop a simplified low cost method for the collection and fixation of pediatric autopsy cells and to determine the quantitative and qualitative adequacy of extracted DNA. Touch and scrape preparations of pediatric liver cells were obtained from 15 cadavers at autopsy and fixed in 95% ethanol or 3:1 methanol:acetic acid. Material prepared by each fixation procedure was submitted to DNA extraction with the Wizard® genomic DNA purification kit for DNA quantification and five of the preparations were amplified by multiplex PCR (azoospermia factor genes). The amount of DNA extracted varied from 20 to 8,640 µg, with significant differences between fixation methods. Scrape preparation fixed in 95% ethanol provided larger amount of extracted DNA. However, the mean for all groups was higher than the quantity needed for PCR (50 ng) or Southern blot (500 ng). There were no qualitative differences among the different material and fixatives. The same results were also obtained for glass slides stored at room temperature for 6, 12, 18 and 24 months. We conclude that touch and scrape preparations fixed in 95% ethanol are a good source of DNA and present fewer limitations than cell culture, tissue paraffin embedding or freezing that require sterile material, culture medium, laboratory equipment and trained technicians. In addition, they are more practical and less labor intensive and can be obtained and stored for a long time at low cost.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Polyembryonic seeds are characterized by the development of over one embryo in the same seed, which can be zygotic and nucellar. The objective of this work was to identify the genetic origin, whether zygotic or nucellar, of seedlings of polyembryonic seeds of 'Ubá' mango tree using ISSR markers, and relating them with the vigor of the seedlings. Thus, mangos were harvested in Visconde do Rio Branco (accession 102) and Ubá (accessions 112, 138, 152 and 159), whose seeds were germinated in plastic trays filled with washed sand. Fifty days after sowing, seedlings from five seeds of each one of the accessions 102, 112, 138, 159 and from 10 seeds of the accession 152, were analyzed. These sseedlings were characterized and evaluated for plant height, stem circumference and mass of fresh aerial part and the most vigorous seedling was the one displaying at least two of these traits higher than the other seedlings from seed. Leaves were collected for genomic DNA extraction, which was amplified using seven ISSR primers previously selected based on the amplification profile and considering the number and resolution of fragments. Zygotic seedlings were found in 18 seeds, which were the most vigorous in six seeds. The results evidenced the existence of genetic variability in orchards using seedlings grown from seeds, because the farmer usually uses the most vigorous ones, assuming that this is of nucellar origin. These results also indicate that the most vigorous seedling are not always nucellar, inasmuch as of 20% of the total seeds evaluated, the zygotic seedling was the most vigorous.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Epidemiological studies on giardiasis by using molecular techniques such as RAPD (Randomly Amplified Polymorphic DNA) may give information on factors related to the transmission of Giardia duodenalis. The aim of this work was to assess the epidemiology of G. duodenalis in 101 children attended at a daycare center in Presidente Bernardes, SP, Brazil. After parasitological examinations in feces samples, 15 children presented cysts of G. duodenalis. Their respective parents, brothers and pets, besides the daycare center workers, also had their feces submitted to parasitological analysis. Seven mothers and nine brothers also presented G. duodenalis cysts, while fathers, daycare workers and pets (dogs) did not presented the parasite. Besides the 15 cases with G. duodenalis, other 23 children presented other enteroparasites (Entamoeba coli, Endolimax nana, Enterobius vermicularis, Ascaris lumbricoides and Trichuris trichiura). Samples of G. duodenalis cysts from children and their relatives were submitted to molecular typing by RAPD after genomic DNA extraction and amplification of a fragment of the 18S rDNA region by PCR. After examining 31 isolates of G. duodenalis (children and their respective mothers and brothers), it was concluded that the parasite transmission occurred in children, probably during daily cohabitation at the daycare center, but not at home among their relatives or pets.