74 resultados para Epidermal lamellae


Relevância:

20.00% 20.00%

Publicador:

Resumo:

C3H mice chronically infected with Leishmania m. mexicana, and in some groups treated with BCG or levamisole, presented atypical epidermal alterations, including pseudoepitheliomatous hyperplasia, hyperkeratosis and dysplasia. These alterations increased in frequency and intensity during the course of infection, but were not related to lesion size or tissue parasite load. Age matched normal, BCG and levamisole treated control mice, examined simultaneously, did not show epidermal modifications. In infected mice the dermis and hypodermis presented an inflammatory infiltrate of histiocytes, lymphocytes and plasma cells, accompanied at times by neutrophils and eosinophils, which did not vary with duration of infection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Various types of "nuages" and "lamellae anulata" can be found during Dermatobia hominis spermatogenesis. In spermatogonia, the "nuages" occur as granules juxtaposed to the cytoplasmic face of the nuclear envelope or as cytoplasmic granules similar to glycogen granules. In spermatocytes, in addition to the "nuages", dense spherical bodies of approximately 1.0 µm in diameter are also observed. In the spermatids the "nuages" can be of the following types: perinuclear granules, spherical granules with diameters varying in length from 0.5 to 1.0 µm, granules similar to glycogen granules, granules with variable diameters which accumulate at the flagellum base forming the centriole adjunct, or remain in the cytoplasm. "Nuages" can also be observed in these cellular types as dense masses, without a definite outline and are common to animal germinal cells in general. The "lamellae anulata" on the other hand, are observed only in spermatocytes I and in early spermatids, being always immersed in electron-dense material of indefinite outline. In spermatids, the "lamellae anulata" are close to the nuclear envelope suggesting, in spite of opposing opinions, that these cells are envolved in the synthesis and transport of material from the nucleus to the cytoplasm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A definition of Biomphalaria helophila (Orbigny, 1835) is presented, based on examination of the shell and reproductive system of topotypic specimens and extended to a number of samples from other localities. The following nominal species and subspecies, collected from type localities, proved junior synonyms of B. helophila: Planorbis albicans Pfeiffer, 1839; Planorbis dentatus Gould, 1844; Planorbis dentiferus CB Adams, 1845; Planorbis dentiferus edentatus CB Adams, 1851; Planorbis dentiens Morelet, 1849; Planorbula dentiens edentula Fischer & Crosse, 1880; Planorbis stagnicola Morelet, 1851; and Tropicorbis shimeki FC Baker, 1945. B. helophila was also identified in samples from Costa Rica, Guatemala, Haiti, Dominican Republic, Puerto Rico and Barbados.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thymus regression upon stressing stimuli, such as infectious diseases, is followed by organ reconstitution, paralleling its development in ontogeny. A narrow window of thymus development was here studied, encompassing the pro-T lymphoid precursor expansion during specification stages, by the use of epidermal growth factor plus insulin (INS) in murine fetal thymus organ cultures. Aiming to disclose signaling pathways related to these stages, cultured thymus lobes had their RNA extracted, for the search of transcripts differentially expressed using RNAse protection assays and reverse transcriptase-polymerase chain reactions. We found no difference that could explain INS-driven thymocyte growth, in the pattern of transcripts for death/proliferation mediators, or for a series of growth factor receptors and transcriptional regulators known as essential for thymus development. Thymocyte suspensions from cultured lobes, stained for phenotype analysis by fluorescence activated cell sorting, showed a decreased staining for Notch1 protein at cell surfaces upon INS addition. We analyzed the expression of Notch-related elements, and observed the recruitment of a specific set of transcripts simultaneous and compatible with INS-driven thymocyte growth, namely, transcripts for Notch3, for its ligand Jagged2, and for Deltex1, a mediator of a poorly characterized alternative pathway downstream of the Notch receptor.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It has been demonstrated that parotid glands of rats infected with Trypanosoma cruzi present severe histological alterations; changes include reduction in density and volume of the acini and duct systems and an increase in connective tissue. We evaluated the association between morphological changes in parotid glands, circulating testosterone levels and epidermal growth factor receptor (EGF-R) expression in experimental Chagas disease in rats. Animals at 18 days of infection (acute phase) showed a significant decrease in body weight, serum testosterone levels and EGF-R expression in the parotid gland compared with a control group. Since decreases in body weight could lead to a reduction in circulating testosterone concentration, we believe that the reduction in EGF-R expression in parotid glands of infected rats is due to alterations in testosterone levels and atrophy of parotid glands is caused by changes in EGF-R expression. Additionally, at 50 days (chronic phase) of infection parotid glands showed a normal histological aspect likely due to the normalization of the body weight. These findings suggest that the testosterone-EGF-R axis is involved in the histological changes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this work was to visualize the association between microcracking and other epidermal chilling injury symptoms, and to identify rots in cucumber fruit (Cucumis sativus L.) by scanning electron microscopy (SEM). Depressed epidermal areas and surface cracking due to damages of subepidermal cells characterized the onset of pitting in cucumber fruit. The germination of conidia of Alternaria alternata, with some of them evident on the fractures in the cultivar Trópico, occurred after damaging on the epidermis. Before, the chilling injury symptoms became visible, Stemphylium herbarum conidia germinated, and mycelium penetrated through the hypodermis using the microcracks as pathway. In the cultivar Perichán 121 the fungus was identified as Botrytis cinerea.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The composition and distribution of the glycoconjugates (GCs) secreted by the epithelium of ovarian lamellae with reference to the reproductive biology of Genypterus blacodes (Schneider, 1801) through lectin hi stochemistry is here discussed. In this species, the epithelial cells that line the ovarian cavity presented sharp morphological variations along the reproductive cycle related to the mucus secretion that accompanies oocyte ma turation. During sp awning season, residues of mannose and N-acetylglucosamine were detected in the glycocalyx of those cells using lectinhistochemistry. N- acetylgalactosamine and fucose were also observed in the same zone. The greatest variations in the lectinhistochemical pattern were found in the apical cytoplasm composition in comparison to the basal zone of the cells. The results of the present study were discussed by comparing their possible functional implications.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Differences in the microscopic morphology of the hoof in forelimbs and hindlimbs of horses have been scarcely reported in the literature, especially concerning the distribution of primary and secondary epidermal laminae in the different regions. This study aimed to determine the density of primary and secondary epidermal laminae in the hoof of horses. For this, it was used fore and hindlimbs of 16 adult mixed breed horses. With a cross section 0.5 cm above the sole, it was quantified the primary epidermal laminae in the regions of the toe, and of lateral and medial quarters. Fragments with about 1cm ³ were taken from the proximal, middle and distal thirds of the hooves, in the different regions, subjected to conventional histological techniques and examined with an optical microscope. Data were statistically analyzed in relation to the fore and hindlimbs and between their various regions. The density of primary epidermal laminae varied around the hoof circumference, with greater values in the hoof toe, which gradually decreased towards the bulb of the hoof, without difference between thoracic and pelvic limbs. The average density of the secondary epidermal laminae per primary epidermal lamina does not change around the circumference of the hoof. Our findings indicated that the density of epidermal laminae is not different between fore and hindlimbs. The variation in the density of primary epidermal laminae around the hoof seems to be part of an adaptive response to different stresses in each region. A better understanding of the structural morphology contributes to a better understanding of the diagnosis, pathophysiology, and treatment of disorders that affect the hoof.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We studied the length of primary and secondary epidermal laminae of the toe and the lateral and medial quarters of horses, distributed into proximal, middle and distal thirds of the hooves. Eight limbs from adult crossbred horses, four females and four males, used to pull carts without pedal conditions. Fragments were taken from different regions of the hooves and subjected to conventional histological techniques. The samples were stained with hematoxylin-eosin and analyzed by light microscopy. The primary epidermal laminae were higher in the hooves of forelimbs compared to hindlimbs in the proximal and middle thirds and the regions of the medial quarter and toe. The secondary laminae were higher in forelimb of the middle third and medial quarter. Comparing the length of the epidermal laminae between hoof parts, it was seen that the primary laminae are lower in the proximal third and higher in the toe, while the secondary laminae are lower in the proximal third and medial quarter. The results suggested that the morphology of the laminae in the different regions of the hooves is influenced through the work performed by the animal, as well as through the different distribution of forces.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human subjects with active vulgar vitiligo do not respond well to autologous dermo-epidermal minigrafting. Eighteen subjects were treated with the a-melanocyte-stimulating hormone (a-MSH) synthetic analogue [Nle4, D-Phe7]-a-MSH. The hormone (50 µl, 0.4 mM) was applied topically to 30-cm2 lesions in which 29-48 minigrafts had been made. The hormone did not improve the success of the minigrafting and no differences were observed in local or distant repigmentation in treated subjects as compared to the placebo group. Aliquots of 24-h urine concentrated by lyophilization irreversibly darkened toad skins, demonstrating the presence of the analogue. This is the first report of the transdermal delivery of a topically applied melanotropin in living human subjects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present study was to measure full epidermal thickness, stratum corneum thickness, rete length, dermal papilla widening and suprapapillary epidermal thickness in psoriasis patients using a light microscope and computer-supported image analysis. The data obtained were analyzed in terms of patient age, type of psoriasis, total body surface area involvement, scalp and nail involvement, duration of psoriasis, and family history of the disease. The study was conducted on 64 patients and 57 controls whose skin biopsies were examined by light microscopy. The acquired microscopic images were transferred to a computer and measurements were made using image analysis. The skin biopsies, taken from different body areas, were examined for different parameters such as epidermal, corneal and suprapapillary epidermal thickness. The most prominent increase in thickness was detected in the palmar region. Corneal thickness was more pronounced in patients with scalp involvement than in patients without scalp involvement (t = -2.651, P = 0.008). The most prominent increase in rete length was observed in the knees (median: 491 µm, t = 10.117, P = 0.000). The difference in rete length between patients with a positive and a negative family history was significant (t = -3.334, P = 0.03), being 27% greater in psoriasis patients without a family history. The differences in dermal papilla distances among patients were very small. We conclude that microscope-supported thickness measurements provide objective results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In vitro propagation has become an effective practice for large-scale production of strawberry plants. The objective of this study was to evaluate the hyperhydricity and the multiplication capacity of two strawberry varieties (Fragaria x ananassa Duch. 'Dover' and 'Burkley') propagated in vitro. Plants maintained in MS medium supplemented with 1.0 mg L-1 BA were individualized and transferred to the same medium solidified with Agar (6.5 g L-1) or Phytagel® (2.5 g L-1) and BA at different concentrations (0; 0.5; 1.0; 2.0 and 3.0 mg L-1). Biochemical and anatomical analyses were carried out, as well as the analysis of the morphological hyperhydricity characteristics. The analysis of data showed: a) the increase in cytokinin concentration increased hyperhydricity frequency in both varieties; b) at concentrations up to 2.0 mg L-1 BA, the replacement of Agar by Phytagel® induced a higher formation of hyperhydric shoots; and c) the addition of BA induced oxidative stress, which is characterized by increased antioxidant activity and lipid peroxidation, as well as alterations at the cellular level, such as malformation of stomata and epidermal cells. In conclusion, the culture medium containing 0.5 mg L-1 BA solidified with Agar provided lower hyperhydricity percentages in association with higher rates of shoot proliferation in strawberry.