AN ANALYSIS OF THE DNA DAMAGE INDUCED BY NICKEL COMPOUNDS IN CHINESE HAMSTER OVARY CELLS (CARCINOGENESIS, HETEROCHROMATIN, CYTOTOXICITY, REPLICATION, PROTEIN CROSSLINKING)

The carcinogenic activity of water-insoluble crystalline nickel sulfide requires phagocytosis and lysosome-mediated intracellular dissolution of the particles to yield Ni('2+). This study investigated the extent and nature of the DNA damage in Chinese hamster ovary cells treated with various nickel compounds using the technique of alkaline elution. Crystalline NiS and water-soluble NiCl(,2) induced single strand breaks that were repaired quickly and DNA-protein crosslinks that persisted up to 24 hr after exposure to nickel. The induction of single strand breaks was concentration dependent at both noncytotoxic and lethal amounts of nickel. The induction of DNA-protein crosslinks was concentration dependent but was absent at lethal amounts of nickel. The cytoplasmic and nuclear uptake of nickel was concentration dependent even at the toxic level of nickel. However, the induction of DNA-protein crosslinks by nickel required active cell cycling and occurred predominantly in mid-late S phase of the cell cycle, suggesting that the lethal amounts of nickel inhibited DNA-protein crosslinking by inhibiting active cell cycling. Since the DNA-protein crosslinking induced by nickel was resistant to DNA repair, the nature of this lesion was investigated using various methods of DNA isolation and chromatin fractionation in combination with SDS-polyacrylamide gel electrophoresis. High molecular weight, non-histone chromosomal proteins and possibly histone 1 were preferentially crosslinked to DNA by nickel. The crosslinked proteins were concentrated in a magnesium-insoluble fraction of sonicated chromatin (5% of the total) that was similar to heterochromatin in solubility and protein composition. Alterations in DNA structure and function, brought about by the effect of nickel on protein-DNA interactions, may be related to the carcinogenicity of nickel compounds. ^

Characterization of hLodestar: A CDC5L interacting protein

Lodestar, a Drosophila maternal-effect gene, is essential for proper chromosome segregation during embryonic mitosis. Mutations in lodestar cause chromatin bridging in anaphase, preventing the sister chromatids from fully separating and leaving chromatin tangled at the metaphase plate. Drosophila lodestar protein was originally identified, in purified fractions of Drosophila Kc cell nuclear extracts, by its ability to suppress the generation of long RNA polymerase II transcripts. The human homolog of this protein (hLodestar) was cloned and studied in comparison to the Drosophila lodestar activities. The results of these studies show, similar to the Drosophila protein, hLodestar has dsDNA-dependent ATPase and transcription termination activity in vitro. hLodestar has also been shown to release RNA polymerase I and II stalled at a cyclobutane thymine dimer. Lodestar belongs to the SNF2 family of proteins, which are members of the DExH/D helicase super-family. The SNF2 family of proteins are believed to play a critical role in altering protein-DNA interactions in a variety of cellular contexts. We have recently isolated a human cDNA (hLodestar) that shares significant homology to the Drosophila lodestar gene. The 4.6 kb clone contains an open reading frame of 1162 amino acids, and shares 55% similarity and 46% identity to the Drosophila Lodestar protein sequence. Our studies looking for hLodestar interacting proteins revealed an association with CDC5L in the yeast two-hybrid system and co-immunoprecipitation experiments. CDC5L has been well documented to be a component of the spliceosome. Our data suggests hLodestar is involved in splicing through in vitro assembly and splicing reactions, in addition to its association with spliceosomes purified from HeLa nuclear extract. Although many other members of the DExH/D helicase super-family have been linked to splicing, this is the first SNF2 family member to be implicated in the splicing reaction. ^

An Sp1/Sp3 binding polymorphism confers methylation protection.

Hundreds of genes show aberrant DNA hypermethylation in cancer, yet little is known about the causes of this hypermethylation. We identified RIL as a frequent methylation target in cancer. In search for factors that influence RIL hypermethylation, we found a 12-bp polymorphic sequence around its transcription start site that creates a long allele. Pyrosequencing of homozygous tumors revealed a 2.1-fold higher methylation for the short alleles (P<0.001). Bisulfite sequencing of cancers heterozygous for RIL showed that the short alleles are 3.1-fold more methylated than the long (P<0.001). The comparison of expression levels between unmethylated long and short EBV-transformed cell lines showed no difference in expression in vivo. Electrophorectic mobility shift assay showed that the inserted region of the long allele binds Sp1 and Sp3 transcription factors, a binding that is absent in the short allele. Transient transfection of RIL allele-specific transgenes showed no effects of the additional Sp1 site on transcription early on. However, stable transfection of methylation-seeded constructs showed gradually decreasing transcription levels from the short allele with eventual spreading of de novo methylation. In contrast, the long allele showed stable levels of expression over time as measured by luciferase and approximately 2-3-fold lower levels of methylation by bisulfite sequencing (P<0.001), suggesting that the polymorphic Sp1 site protects against time-dependent silencing. Our finding demonstrates that, in some genes, hypermethylation in cancer is dictated by protein-DNA interactions at the promoters and provides a novel mechanism by which genetic polymorphisms can influence an epigenetic state.

Macromolecular interaction studies on FF1-3 of human CA150 and STAT1-importin alpha5 using biophysical and biochemical methods

Macromolecular interactions, such as protein-protein interactions and protein-DNA interactions, play important roles in executing biological functions in cells. However the complexity of such interactions often makes it very challenging to elucidate the structural details of these subjects. In this thesis, two different research strategies were applied on two different two macromolecular systems: X-ray crystallography on three tandem FF domains of transcription regulator CA150 and electron microscopy on STAT1-importin α5 complex. The results from these studies provide novel insights into the function-structure relationships of transcription coupled RNA splicing mediated by CA150 and the nuclear import process of the JAK-STAT signaling pathway. ^ The first project aimed at the protein-protein interaction module FF domain, which often occurs as tandem repeats. Crystallographic structure of the first three FF domains of human CA150 was determined to 2.7 Å resolution. This is the only crystal structure of an FF domain and the only structure on tandem FF domains to date. It revealed a striking connectivity between an FF domain and the next. Peptide binding assay with the potential binding ligand of FF domains was performed using fluorescence polarization. Furthermore, for the first time, FF domains were found to potentially interact with DNA. DNA binding assays were also performed and the results were supportive to this newly proposed functionality of an FF domain. ^ The second project aimed at understanding the molecular mechanism of the nuclear import process of transcription factor STAT1. The first structural model of pSTAT1-importin α5 complex in solution was built from the images of negative staining electron microscopy. Two STAT1 molecules were observed to interact with one molecule of importin α5 in an asymmetric manner. This seems to imply that STAT1 interacts with importin α5 with a novel mechanism that is different from canonical importin α-cargo interactions. Further in vitro binding assays were performed to obtain more details on the pSTAT1-importin α5 interaction. ^

Cloning and characterization of the mouse ret finger protein (rfp), a B box zinc finger protein

An important question in biology is to understand the role of specific gene products in regulating embryogenesis and cellular differentiation. Many of the regulatory proteins possess specific motifs, such as the homeodomain, basic helix-loop-helix structure, zinc finger, and leucine zipper. These sequence motifs participate in specific protein-DNA, protein-RNA, and protein-protein interactions, and are important for the function of these regulatory proteins.^ The human rfp (ret finger protein) belongs to a novel zinc finger protein family, the B box zinc finger family. Most of the B box proteins, including rfp, have a conserved tripartite motif, consisting of two novel zinc fingers (the RING finger and the B box) and a coiled-coil domain. Interestingly, a fusion protein between the tripartite motif of rfp and the tyrosine kinase domain of c-ret has transforming activity. In this study, we examined the expression of rfp during mouse development, and characterized the role of the tripartite motif in rfp function.^ We cloned the mouse rfp cDNA, which shares a 98.4% homology with the human sequence at amino acid level. Such strikingly high degree of homology indicates the high evolutionary pressure on the conservation of the sequence, suggesting that rfp may have an important function. Using the somatic cell hybrid system, we assigned the rfp gene to mouse chromosome 13 and human chromosome 6. Rfp transcripts and protein were ubiquitous in day 10.5-13.5 mouse embryos; however, they were restricted in adult mice, with the highest level of expression in the testis. Rfp expression in the testis is detected only in late pachytene spermatocytes and round spermatids. In both embryos and spermatogenic cells, rfp protein was distributed within cell nuclei in a punctate pattern, similar to the PODs (PML oncogenic domains) observed with another B box protein, PML. In cultured mammalian cells, we found that rfp was indeed co-localized to the PODs with PML. Using the yeast two-hybrid system, we showed that the rfp could specifically interact with PML, and that the interaction was dependent on the distal portion of the rfp coiled-coil domain.^ We also showed that rfp could form homodimers, and both the B box and coiled-coil domain were required for proper dimerization. It seems that the proximal portion of the coiled-coil domain provides the interacting interface, while the B box zinc finger orients the coil and maintains the correct structure of the whole molecule. Our data are consistent with the zinc-binding property and structural analysis of the B box. The RING finger seems to be involved in rfp nuclear localization through interaction with other proteins. We believe that homodimerization and interaction with PML are important for the normal interaction of rfp during development and differentiation. In addition, rfp homodimerization may also be essential for the oncogenic activation of the rfp-ret fusion protein. ^

Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

Mechanism of subunit interaction and DNA binding of the heterotrimeric CCAAT binding factor CBF

Many eukaryotic promoters contain a CCAAT element at a site close ($-$80 to $-$120) to the transcription initiation site. CBF (CCAAT Binding Factor), also called NF-Y and CP1, was initially identified as a transcription factor binding to such sites in the promoters of the Type I collagen, albumin and MHC class II genes. CBF is a heteromeric transcription factor and purification and cloning of two of the subunits, CBF-A and CBF-B revealed that it was evolutionarily conserved with striking sequence identities with the yeast polypeptides HAP3 and HAP2, which are components of a CCAAT binding factor in yeast. Recombinant CBF-A and CBF-B however failed to bind to DNA containing CCAAT sequences. Biochemical experiments led to the identification of a third subunit, CBF-C which co-purified with CBF-A and complemented the DNA binding of recombinant CBF-A and CBF-B. We have recently isolated CBF-C cDNAs and have shown that bacterially expressed purified CBF-C binds to CCAAT containing DNA in the presence of recombinant CBF-A and CBF-B. Our experiments also show that a single molecule each of all the three subunits are present in the protein-DNA complex. Interestingly, CBF-C is also evolutionarily conserved and the conserved domain between CBF-C and its yeast homolog HAP5 is sufficient for CBF-C activity. Using GST-pulldown experiments we have demonstrated the existence of protein-protein interaction between CBF-A and CBF-C in the absence of CBF-B and DNA. CBF-B on other hand, requires both CBF-A and CBF-C to form a ternary complex which then binds to DNA. Mutational studies of CBF-A have revealed different domains of the protein which are involved in CBF-C interaction and CBF-B interaction. In addition, CBF-A harbors a domain which is involved in DNA recognition along with CBF-B. Dominant negative analogs of CBF-A have also substantiated our initial observation of assembly of CBF subunits. Our studies define a novel DNA binding structure of heterotrimeric CBF, where the three subunits of CBF follow a particular pathway of assembly of subunits that leads to CBF binding to DNA and activating transcription. ^

Searching for the ideal DNA recognition code of covalent ligands

The combitiatorial approach restriction endonuclease protection selection and amplification REPSA was successfully used to determine ideal DNA interactions sites of covalent ligands. Unlike most other combinatorial methods, REPSA is based on inhibition of enzymatic cleavage by specific ligand-DNA complexes, which enables identification of binding sites of various ligands. However, the inherent nature of this technique posses a problem during selection of binding sites of covalent ligands. By modifying the technique according to the nature of the ligand, we demonstrate the flexibility of REPSA in identifying the preferred binding sites for monocovalent ligands, topoisomerase I and tallimustine, and the bicovalent ligand topoisomerase II. From among the preferred binding sites, we identified the consensus binding sequence of camptothecin induced topoisomerase I cleavage as ‘aGWT/Gc’, and tallimustine consensus sequences as ‘GTTCTA’ and ‘TTTTTTC’. We have shown for the first time that preferential binding of tallimustine occurs at sequences not previously reported. Furthermore, our data indicate that tallimustine is a novel DNA minor groove, guanine-specific alkylating agent. ^ Additionally, we have demonstrated in vivo that sequence-specific covalent DNA-binding small molecules have the ability to regulate transcription by inhibiting RNA polymerase II. Tallimustine, binding to its preferred sequences located in the 5′ untranslated region were an effective impediment for transcribing polymerase II. The ability of covalent binding small molecules to target predetermined DNA sequences located downstream of the promoter suggests a general approach for regulation of gene expression. ^

CREB trans-activation of disruptor of telomeric silencing-1 mediates forskolin inhibition of CTGF transcription in mesangial cells.

Connective tissue growth factor (CTGF) participates in diverse fibrotic processes including glomerulosclerosis. The adenylyl cyclase agonist forskolin inhibits CTGF expression in mesangial cells by unclear mechanisms. We recently reported that the histone H3K79 methyltransferase disruptor of telomeric silencing-1 (Dot1) suppresses CTGF gene expression in collecting duct cells (J Clin Invest 117: 773-783, 2007) and HEK 293 cells (J Biol Chem In press). In the present study, we characterized the involvement of Dot1 in mediating the inhibitory effect of forskolin on CTGF transcription in mouse mesangial cells. Overexpression of Dot1 or treatment with forskolin dramatically suppressed basal CTGF mRNA levels and CTGF promoter-luciferase activity, while hypermethylating H3K79 in chromatin associated with the CTGF promoter. siRNA knockdown of Dot1 abrogated the inhibitory effect of forskolin on CTGF mRNA expression. Analysis of the Dot1 promoter sequence identified a CREB response element (CRE) at -384/-380. Overexpression of CREB enhanced forskolin-stimulated Dot1 promoter activity. A constitutively active CREB mutant (CREB-VP16) strongly induced Dot1 promoter-luciferase activity, whereas overexpression of CREBdLZ-VP16, which lacks the CREB DNA-binding domain, abolished this activation. Mutation of the -384/-380 CRE resulted in 70% lower levels of Dot1 promoter activity. ChIP assays confirmed CREB binding to the Dot1 promoter in chromatin. We conclude that forskolin stimulates CREB-mediated trans-activation of the Dot1 gene, which leads to hypermethylation of histone H3K79 at the CTGF promoter, and inhibition of CTGF transcription. These data are the first to describe regulation of the Dot1 gene, and disclose a complex network of genetic and epigenetic controls on CTGF transcription.

Mechanisms of HER2/{\it neu\/} proto-oncogene overexpression in breast cancer cells

Overexpression and amplification of HER2/neu have been documented in many primary tumors, most notably in breast. Not only do approximately 30% of breast cancer patients carry tumors that overexpress the gene, but those that do generally have shorter overall and disease-free survival times than patients with tumors expressing low levels of HER2/neu. Thus, overexpression of HER2/neu plays an important role in the pathogenesis of breast cancer. We have examined the mechanisms that result in HER2/neu overexpression in breast cancer by using, as a model system, established breast cancer cell lines that express much higher levels of HER2/neu mRNA than normal breast tissue while maintaining a near normal HER2/neu gene copy number. Nuclear run-on experiments indicate that the breast cancer cell lines MDA-MB453, BT483, and BT474 have an increased HER2/neu gene transcription rate. By using HER2/neu promoter-CAT constructs, we have found that the enhanced HER2/neu transcription rate in MDA-MB453 cells is due to activation of the gene in trans, while the enhanced transcription rate in BT483 cells is due to activation of the gene in either trans or cis. In BT474 cells, transcriptional upregulation is primarily due to gene amplification. Since the levels of increased transcription are not as high as the levels of HER2/neu mRNA in any of these three lines, post-transcriptional deregulation that increases HER2/neu expression must also be functioning in these cells. The half-life of HER2/neu mRNA was measured and found to be equivalent in these lines as in a control. Thus, the post-transcriptional deregulation is not increased stability of the HER2/neu transcript.^ Much work has been performed in characterizing the altered trans-acting factor involved in increased HER2/neu transcription in MDA-MB453 cells. Using promoter deletion constructs linked to a reporter gene, the region responsive to this factor was localized in the rat neu promoter. When human HER2/neu promoter constructs were used, the homologous sequence in the human promoter was identified. Furthermore, a number of protein/DNA complexes are detected when these promoter regions are used in gel mobility shift assays. UV-crosslinking experiments indicate DNA-binding proteins of roughly 110 kDa, 70 kDa, and 35 kDa are capable of interacting with the human promoter element. ^

Analysis of p53 function and regulation

p53 is a tumor suppressor gene that is the most frequent target inactivated in cancers. Overexpression of wild-type p53 in rat embryo fibroblasts suppresses foci formation by other cooperating oncogenes. Introduction of wild-type p53 into cells that lack p53 arrests them at the G1/S boundary and reverses the transformed phenotype of some cells. The function of p53 in normal cells is illustrated by the ability of p53 to arrest cells at G1 phase of the cell cycle upon exposure to DNA-damaging agents including UV-irradiation and biosynthesis inhibitors.^ Since the amino acid sequence of p53 suggested that it may function as a transcription factor, we used GAL4 fusion assays to test that possibility. We found that wild-type p53 could specifically activate transcription when anchored by the GAL4 DNA binding domain. Mutant p53s, which have lost the ability to suppress foci formation by other oncogenes, were not able to activate transcription in this assay. Thus, we established a direct correlation between the tumor suppression and transactivation functions of p53.^ Having learned that p53 was a transcriptional activator, we next sought targets of p53 activation. Because many transcription factors regulate their own expression, we tested whether p53 had this autoregulatory property. Transient expression of wild-type p53 in cells increased the levels of endogenous p53 mRNA. Cotransfection of p53 together with a reporter bearing the p53 promoter confirmed that wild-type p53 specifically activates its own promoter. Deletion analysis from both the 5$\sp\prime$ and 3$\sp\prime$ ends of the promoter minimized the region responsible for p53 autoregulation to 45 bp. Methylation interference identified nucleotides involved in protein-DNA interaction. Mutations within this protected site specifically eliminated the response of the promoter to p53. In addition, multiple copies of this element confer responsiveness to wild-type p53 expression. Thus, we identified a F53 responsive element within the p53 promoter.^ The presence of a consensus NF-$\kappa$B site in the p53 promoter suggested that NF-KB may regulate p53 expression. Gel-shift experiments showed that both the p50 homodimer and the p50/p65 heterodimer bind to the p53 promoter. In addition, the p65 subunit of NF-$\kappa$B activates the p53 promoter in transient transfection experiments. TNF $\alpha$, a natural NF-$\kappa$B inducer, also activates the p53 promoter. Both p65 activation and TNF $\alpha$ induction require an intact NF-$\kappa$B site in the p53 promoter. Since NF-$\kappa$B activation occurs as a response to stress and p53 arrests cells in G1/S, where DNA repair occurs, activation of p53 by NF-$\kappa$B could be a mechanism by which cells recover from stress.^ In conclusion, we provided the first data that wild-type p53 functions as a transcriptional activator, whereas mutant p53 cannot. The correlation between growth suppression and transcriptional activation by p53 implies a pathway of tumor suppression. We have analyzed upstream components of the pathway by the identification of both p53 and NF-$\kappa$B as regulators of the p53 promoter. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Plasticity of lipid-protein interactions in the function and topogenesis of the membrane protein lactose permease from Escherichia coli.

Phosphatidylcholine (PC) has been widely used in place of naturally occurring phosphatidylethanolamine (PE) in reconstitution of bacterial membrane proteins. However, PC does not support native structure or function for several reconstituted transport proteins. Lactose permease (LacY) of Escherichia coli, when reconstituted in E. coli phospholipids, exhibits energy-dependent uphill and energy-independent downhill transport function and proper conformation of periplasmic domain P7, which is tightly linked to uphill transport function. LacY expressed in cells lacking PE and containing only anionic phospholipids exhibits only downhill transport and lacks native P7 conformation. Reconstitution of LacY in the presence of E. coli-derived PE, but not dioleoyl-PC, results in uphill transport. We now show that LacY exhibits uphill transport and native conformation of P7 when expressed in a mutant of E. coli in which PC completely replaces PE even though the structure is not completely native. E. coli-derived PC and synthetic PC species containing at least one saturated fatty acid also support the native conformation of P7 dependent on the presence of anionic phospholipids. Our results demonstrate that the different effects of PE and PC species on LacY structure and function cannot be explained by differences in the direct interaction of the lipid head groups with specific amino acid residues alone but are due to more complex effects of the physical and chemical properties of the lipid environment on protein structure. This conclusion is supported by the effect of different lipids on the proper folding of domain P7, which indirectly influences uphill transport function.

Protein-Protein Interactions That Regulate Neurotransmitter Release from Retinal Ribbon Synapses

Protein-Protein Interactions That Regulate Neurotransmitter Release from Retinal Ribbon Synapses Photoreceptors and bipolar cells in the retina form specialized chemical synapses called ribbon synapses. This type of synapse differs physiologically from “conventional” chemical synapses. While “conventional” synapses exocytose neurotransmitter-filled vesicles in an all-or-none fashion in response to an action potential, a retinal ribbon synapse can release neurotransmitter tonically (sustained) in response to graded changes in membrane potential or phasically (transient) in response to a large change in membrane potential. Synaptic vesicle exocytosis is a tightly controlled process involving many protein-protein interactions. Therefore, it is likely that the dissimilarity in the release properties of retinal ribbon synapses and conventional synapses is the result of molecular differences between the two synapse types. Consistent with this idea, previous studies have demonstrated that ribbon synapses in the retina do not contain the t-SNARE (target-soluble N-ethylmaleimide-sensitive factor attachment protein receptor) syntaxin 1A that is found in conventional synapses of the nervous system. In contrast, ribbon synapses of the mammalian retina contain the related isoform, syntaxin 3B. Given that SNARE proteins play an important role in neurotransmitter release in conventional synapses, the purpose of this study was to characterize syntaxin 3B in order to elucidate what role this protein plays in neurotransmitter release from retinal ribbon synapses. Using molecular and biochemical techniques, it was demonstrated that syntaxin 3B is a binding partner of several presynaptic proteins that play a important role in synaptic vesicle exocytosis from retinal ribbon synapses and it is an evolutionarily conserved protein.

Lipid-protein interactions drive membrane protein topogenesis in accordance with the positive inside rule.

Transmembrane domain orientation within some membrane proteins is dependent on membrane lipid composition. Initial orientation occurs within the translocon, but final orientation is determined after membrane insertion by interactions within the protein and between lipid headgroups and protein extramembrane domains. Positively and negatively charged amino acids in extramembrane domains represent cytoplasmic retention and membrane translocation forces, respectively, which are determinants of protein orientation. Lipids with no net charge dampen the translocation potential of negative residues working in opposition to cytoplasmic retention of positive residues, thus allowing the functional presence of negative residues in cytoplasmic domains without affecting protein topology.