An interaction between two RNA binding proteins, Nab2 and Pub1, links mRNA Processing/Export and mRNA stability

mRNA stability is modulated by elements in the mRNA transcript and their cognate RNA binding proteins. Poly(U) binding protein 1 (Pub1) is a cytoplasmic Saccharomyces cerevisiae mRNA binding protein that stabilizes transcripts containing AU-rich elements (AREs) or stabilizer elements (STEs). In a yeast two-hybrid screen, we identified nuclear poly(A) binding protein 2 (Nab2) as being a Pub1-interacting protein. Nab2 is an essential nucleocytoplasmic shuttling mRNA binding protein that regulates poly(A) tail length and mRNA export. The interaction between Pub1 and Nab2 was confirmed by copurification and in vitro binding assays. The interaction is mediated by the Nab2 zinc finger domain. Analysis of the functional link between these proteins reveals that Nab2, like Pub1, can modulate the stability of specific mRNA transcripts. The half-life of the RPS16B transcript, an ARE-like sequence-containing Pub1 target, is decreased in both nab2-1 and nab2-67 mutants. In contrast, GCN4, an STE-containing Pub1 target, is not affected. Similar results were obtained for other ARE- and STE-containing Pub1 target transcripts. Further analysis reveals that the ARE-like sequence is necessary for Nab2-mediated transcript stabilization. These results suggest that Nab2 functions together with Pub1 to modulate mRNA stability and strengthen a model where nuclear events are coupled to the control of mRNA turnover in the cytoplasm.

Arginine methylation and binding of Hrp1p to the efficiency element for mRNA 3'-end formation

Hrp1p is a heterogeneous ribonucleoprotein (hnRNP) from the yeast Saccharomyces cerevisiae that is involved in the cleavage and polyadenylation of the 3'-end of mRNAs and mRNA export. In addition, Hrp1p is one of several RNA-binding proteins that are posttranslationally modified by methylation at arginine residues. By using-functional recombinant Hrp1p, we have identified RNA sequences with specific high affinity binding sites. These sites correspond to the efficiency element for mRNA 3'-end formation, UAUAUA. To examine the effect of methylation on specific RNA binding, purified recombinant arginine methyltransferase (Hmt1p) was used to methylate Hrp1p. Methylated Hrp1p binds with the same affinity to UAUAUA-containing RNAs as unmethylated Hrp1p indicating that methylation does not affect specific RNA binding. However, RNA itself inhibits the methylation of Hrp1p and this inhibition is enhanced by RNAs that specifically bind Hrp1p. Taken together, these data support a model in which protein methylation occurs prior to protein-RNA binding in the nucleus.

Análise funcional e estrutural da proteína Pub 1 de Saccharomyces cerevisiae

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Loss of nuclear poly(A)-binding protein 1 causes defects in myogenesis and mRNA biogenesis

The nuclear poly(A)-binding protein 1 (PABPN1) is a ubiquitously expressed protein that plays a critical role in polyadenylation. Short expansions of the polyalanine tract in the N-terminus of PABPN1 lead to oculopharyngeal muscular dystrophy (OPMD), which is an adult onset disease characterized by eyelid drooping, difficulty in swallowing and weakness in the proximal limb muscles. Although significant data from in vitro biochemical assays define the function of PABPN1 in control of poly(A) tail length, little is known about the role of PABPN1 in mammalian cells. To assess the function of PABPN1 in mammalian cells and specifically in cells affected in OPMD, we examined the effects of PABPN1 depletion using siRNA in primary mouse myoblasts from extraocular, pharyngeal and limb muscles. PABPN1 knockdown significantly decreased cell proliferation and myoblast differentiation during myogenesis in vitro. At the molecular level, PABPN1 depletion in myoblasts led to a shortening of mRNA poly(A) tails, demonstrating the cellular function of PABPN1 in polyadenylation control in a mammalian cell. In addition, PABPN1 depletion caused nuclear accumulation of poly(A) RNA, revealing that PABPN1 is required for proper poly(A) RNA export from the nucleus. Together, these experiments demonstrate that PABPN1 plays an essential role in myoblast proliferation and differentiation, suggesting that it is required for muscle regeneration and maintenance in vivo.

Contributions and perspectives of chicken genomics in Brazil: from biological model to export commodity

Chicken is one of the most important sources of animal protein for human consumption, and breeding programmes have been responsible for constant improvements in production efficiency and product quality. Furthermore, chicken has largely contributed to fundamental discoveries in biology for the last 100 years. In this article we review recent developments in poultry genomics and their contribution to adding functional information to the already existing structural genomics, including the availability of the complete genome sequence, a comprehensive collection of mRNA sequences ( ESTs), microarray platforms, and their use to complement QTL mapping strategies in the identification of genes that underlie complex traits. Efforts of the Brazilian Poultry Genomics Programme in this area resulted in generation of a resource population, which was used for identification of Quantitative Trait Loci ( QTL) regions, generation of ESTs and candidate gene studies that contributed to furthering our understanding of the complex biological processes involved in growth and muscular development in chicken.

Loss of nuclear poly(A)-binding protein 1 (PABPN1) causes defects in myogenesis and mRNA biogenesis

The nuclear poly(A)-binding protein 1 (PABPN1) is a ubiquitously expressed protein that plays a critical role in polyadenylation. Short expansions of the polyalanine tract in the N-terminus of PABPN1 lead to oculopharyngeal muscular dystrophy (OPMD), which is an adult onset disease characterized by eyelid drooping, difficulty in swallowing and weakness in the proximal limb muscles. Although significant data from in vitro biochemical assays define the function of PABPN1 in control of poly(A) tail length, little is known about the role of PABPN1 in mammalian cells. To assess the function of PABPN1 in mammalian cells and specifically in cells affected in OPMD, we examined the effects of PABPN1 depletion using siRNA in primary mouse myoblasts from extraocular, pharyngeal and limb muscles. PABPN1 knockdown significantly decreased cell proliferation and myoblast differentiation during myogenesis in vitro. At the molecular level, PABPN1 depletion in myoblasts led to a shortening of mRNA poly(A) tails, demonstrating the cellular function of PABPN1 in polyadenylation control in a mammalian cell. In addition, PABPN1 depletion caused nuclear accumulation of poly(A) RNA, revealing that PABPN1 is required for proper poly(A) RNA export from the nucleus. Together, these experiments demonstrate that PABPN1 plays an essential role in myoblast proliferation and differentiation, suggesting that it is required for muscle regeneration and maintenance in vivo.

Hepatic mRNA expression and plasma levels of insulin-like growth factor-I (IGF-I) in broiler chickens selected for different growth rates

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Thyroid status, but not insulin status, affects expression of avian uncoupling protein mRNA in chicken

The aim of this study was to investigate the hormonal regulation of the avian homolog of mammalian uncoupling protein (avUCP) by studying the impact of thyroid hormones and insulin on avUCP mRNA expression in chickens (Gallus gallus). For 3 wk, chicks received either a standard diet (control group), or a standard diet supplemented with triiodothyronine (T-3; T3 group) or with the thyroid gland inhibitor methimazole (MMI group). A fourth group received injections of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th wk of age, all animals received two daily injections of either human insulin or saline solution. The results indicate a twofold overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a clear downregulation (-74%) in MMI chickens compared with control chickens. Insulin injections had no significant effect on avUCP mRNA expression in chickens. This study describes for the first time induction of avUCP mRNA expression by the thermogenic hormone T3 in chickens and supports a possible involvement of avUCP in avian thermogenesis.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Splice variants of the human ZC3H14 gene generate multiple isoforms of a zinc finger polyadenosine RNA binding protein

The human ZC3H14 gene encodes an evolutionarily conserved Cys(3)His zinc finger protein that binds specifically to polyadenosine RNA and is thus postulated to modulate post-transcriptional gene expression. Expressed sequence tag (EST) data predicts multiple splice variants of both human and mouse ZC3H14. Analysis of ZC3H14 expression in both human cell lines and mouse tissues confirms the presence of multiple alternatively spliced transcripts. Although all of these transcripts encode protein isoforms that contain the conserved C-terminal zinc finger domain, suggesting that they could all bind to polyadenosine RNA, they differ in other functionally important domains. Most of the alternative transcripts encode closely related proteins (termed isoforms 1, 2. 3, and 3short) that differ primarily in the inclusion of three small exons, 9, 10, and 11, resulting in predicted protein isoforms ranging from 82 to 64 kDa. Each of these closely related isoforms contains predicted classical nuclear localization signals (cNLS) within exons 7 and 11. Consistent with the presence of these putative nuclear targeting signals, these ZC3H14 isoforms are all localized to the nucleus. In contrast, an additional transcript encodes a smaller protein (34 kDa) with an alternative first exon (isoform, 4). Consistent with the absence of the predicted cNLS motifs located in exons 7 and 11, ZC3H14 isoform 4 is localized to the cytoplasm. Both EST data and experimental data suggest that this variant is enriched in testes and brain. Using an antibody that detects endogenous ZC3H14 isoforms 1-3 reveals localization of these isoforms to nuclear speckles. These speckles co-localize with the splicing factor, SC35, suggesting a role for nuclear ZC3H14 in mRNA processing. Taken together, these results demonstrate that multiple transcripts encoding several ZC3H14 isoforms exist in vivo. Both nuclear and cytoplasmic ZC3H14 isoforms could have distinct effects on gene expression mediated by the common Cys(3)His zinc finger polyadenosine RNA binding domain. (C) 2009 Elsevier B.V. All rights reserved.

Is there a role for eIF5A in translation?

The putative translation factor eIF5A is essential for cell viability and is highly conserved from archaebacteria to mammals. This factor is the only cellular protein that undergoes an essential posttranslational modification dependent on the polyamine spermidine, called hypusination. This review focuses on the functional characterization of eIF5A. Although this protein was originally identified as a translation initiation factor, subsequent studies did not support a role for eIF5A in general translation initiation. eIF5A has also been implicated in nuclear export of HIV-1 Rev and mRNA decay, but these findings are controversial in the literature and may reflect secondary effects of eIF-5A function. Next, the involvement of eIF5A and hypusination in the control of the cell cycle and proliferation in various organisms is reviewed. Finally, recent evidence in favor of reconsidering the role of eIF5A as a translation factor is discussed. Future studies may reveal the specific mechanism by which eIF5A affects protein synthesis.

Dexamethasone-induced insulin resistance is associated with increased connexin 36 mRNA and protein expression in pancreatic rat islets

Augmented glucose-stimulated insulin secretion (GSIS) is an adaptive mechanism exhibited by pancreatic islets from insulin-resistant animal models. Gap junction proteins have been proposed to contribute to islet function. As such, we investigated the expression of connexin 36 (Cx36), connexin 43 (Cx43), and the glucose transporter Glut2 at mRNA and protein levels in pancreatic islets of dexamethasone (DEX)-induced insulin-resistant rats. Study rats received daily injections of DEX (1 mg/kg body mass, i.p.) for 5 days, whereas control rats (CTL) received saline solution. DEX rats exhibited peripheral insulin resistance, as indicated by the significant postabsorptive insulin levels and by the constant rate for glucose disappearance (K-ITT). GSIS was significantly higher in DEX islets (1.8-fold in 16.7 mmol/L glucose vs. CTL, p < 0.05). A significant increase of 2.25-fold in islet area was observed in DEX vs. CTL islets (p < 0.05). Cx36 mRNA expression was significantly augmented, Cx43 diminished, and Glut2 mRNA was unaltered in islets of DEX vs. CTL (p < 0.05). Cx36 protein expression was 1.6-fold higher than that of CTL islets (p < 0.05). Glut2 protein expression was unaltered and Cx43 was not detected at the protein level. We conclude that DEX-induced insulin resistance is accompanied by increased GSIS and this may be associated with increase of Cx36 protein expression.

Inflammatory cytokine mRNA detection by real time PCR in chorioamniotic membranes from pregnant women with preterm premature rupture of membranes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Sequencing and expression analysis of hepcidin mRNA in donkey (Equus asinus) liver

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)