244 resultados para Dimethyl sulfoxide (DMSO)
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The influence of small amounts of bovine serum albumin (BSA) (nM concentration) on the lateral organization of phospholipid monolayers at the air-water interface and transferred onto solid substrates as one-layer Langmuir-Blodgett (LB) films was investigated. The kinetics of adsorption of BSA onto the phospholipid monolayers was monitored with surface pressure isotherms in a Langmuir trough, for the zwitterionic dipalmitoylphosphatidyl ethanolamine (N,N-dimethyl-PE) and the anionic dimyristoylphosphatidic acid (DMPA). A monolayer of N,N-dimethyl-PE or DMPA incorporating BSA was transferred onto a solid substrate using the Langmuir-Blodgett technique. Atomic force microscopy (AFM) images of one-layer LB films displayed protein-phospholipid domains, whose morphology was characterized using dynamic scaling theories to calculate roughness exponents. For DMPA-BSA films the surface is characteristic of self-affine fractals, which may be described with the Kardar-Parisi-Zhang (KPZ) equation. on the other hand, for N,N-dimethyl-PE-BSA films, the results indicate a relatively flat surface within the globule. The height profile and the number and size of globules varied with the type of phospholipid. The overall results, from kinetics of adsorption on Langmuir monolayers and surface morphology in LB films, could be interpreted in terms of the higher affinity of BSA to the anionic DMPA than to the zwitterionic N,N-dimethyl-PE. Furthermore, the effects from such small amounts of BSA in the monolayer point to a cooperative response of DMPA and N,N-dimethyl-PE monolayers to the protein. (c) 2005 Elsevier B.V. All rights reserved.
Resumo:
The pyrazole ligand 3,5-dimethyl-4-iodopyrazole (HdmIPz) has been used to obtain a series of palladium(II) complexes (1-4) of the type [PdX(2)(HdmIPz)(2)] {X = Cl(-) (1); Br(-) (2); I(-) (3); SCN(-) (4)}. All compounds have been isolated, purified, and characterized by means of elemental analysis, IR spectroscopy, (1)H and (13)C{(1)H}-NMR experiments, differential thermal analysis (DTA), and thermogravimetry (TG). The TG/DTA curves showed that the compounds released ligands in the temperature range 137-605 A degrees C, yielding metallic palladium as final residue. The complexes and the ligand together with cisplatin have been tested in vitro by MTT assay for their cytotoxicity against two murine cancer cell lines: mammary adenocarcinoma (LM3) and lung adenocarcinoma (LP07).
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Two alkaloids, erysodine (1) and erysothrine (2) were isolated from the flowers of a Pakistani medicinal plant, Erythrina suberosa. These compounds were investigated for anxiolytic properties, and the results showed significant effect, in an acute oral treatment with 1-2, which were suspended in saline (NaCl 0.9%) plus DMSO 1%, and evaluated in 122 Swiss male mice exposed to two tests of anxiety - the elevated plus-maze (EPM) and the light/dark transition model (LDTM).
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
A high performance liquid chromatography (HPLC) method for extraction and determination of pesticides from raw milk was developed. The method involves direct injection of raw milk samples on a bovine serum albumin-dimethyl-octyl-silica gel (BSA-Si-Cs) column. The mobile phase 0.05 mol.L-1 phosphate buffer pH6.0 in acetonitrile (70:30 v/v) was employed for extraction and separation of bendiocarb, methylparathion, pentachlorophenol, and methomyl pesticides. The method shows good results of recovery in the pesticides studied, higher than 99.6%.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This paper deals with the study of optical, structural and biocompatible properties of PEO-like plasma polymerized films resulting from RF excited diethylene glycol dimethyl ether (CH3O(CH2CH2O)(2)CH3 diglyme) glow discharges. The study was carried out using visible-ultraviolet and FTIR spectroscopies and contact angle measurements. FTIR spectra of plasma polymerized diglyme showed a stronger presence of ethylene glycol groups in film structure for lower RF power levels. The contact angle measurements for water revealed an increasing from 30degrees to 62,5degrees when the RF power was varied from 2 to 45 W, indicating the decreasing of the hydrophilic character of diglyme films with the increasing of RF power. This trend is in agreement with FTIR results. The data from visible-ultraviolet reflectance and transmittance spectra revealed alterations on optical properties of plasma polymerized diglyme films. The film's optical gap varied from 3.8 to 3 eV for RF power running from 5 to 45 W.
Resumo:
Aqueous-based polyurethane dispersions have been widely utilized as lubricants in textile, shoes, automotive, biomaterial and many other industries because they are less aggressive to surrounding environment. In this work thin films with different thickness were deposited on biocompatible polyurethane by plasma polymerization process using diethylene glycol dimethyl ether (Diglyme) as monomer. Molecular structure of the films was analyzed by Fourier Transform Infrared spectroscopy. The spectra exhibited absorption bands of O-H (3500-3200cm(-1)), C-H (3000-2900cm(-1)), C=O (1730-1650cm(-1)), C-O and C-O-C bonds at 1200-1600cm(-1). The samples wettability was evaluated by measurements of contact angle using different liquids such as water, glycerol, poly-ethane and CMC. The polyurethane surface showed hydrophilic behavior after diglyme plasma-deposition with contact angle dropping from 85(0) to 22(0). Scanning Electron Microscopy revealed that diglyme films covered uniformly the polyurethane surfaces ensuring to it a biocompatible characteristic.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Pintos de corte com um dia de idade foram tratados com microbiota cecal cultivada em condição de aerobiose, nos tempos de congelamento de 90, 200, 290 e 360 dias, e associada aos crioprotetores sacarose, trealose, dimetilsulfóxido (DMSO) e glicerol. Posteriormente as aves foram desafiadas com Salmonella Enteritidis, visando determinar a eficácia dos tratamentos em relação à quantidade de bactérias viáveis da microbiota que foi maior aos 90 dias (10,58 Log10 UFC/ml), quando as aves foram tratadas com sacarose, e menor aos 290 dias, quando tratadas com glicerol (7,73 Log10 UFC/ml). No tempo zero, todas as aves apresentaram Salmonella (100%) quando tratadas com DMSO e glicerol, com colonização cecal de 4,9 e 5,2 Log10 UFC/g do conteúdo cecal, respectivamente; aos 360 dias nenhuma ave foi infectada, independente do tratamento. A microbiota cecal, independente de tratamento, sempre determinou menor quantidade de S. Enteritidis em qualquer um dos parâmetros pesquisados, quando comparada com a das aves não tratadas. O congelamento em nitrogênio líquido foi eficaz na manutenção da viabilidade da microbiota cecal até 360 dias.
Resumo:
PURPOSE. Amniotic membrane transplantation (AMT) has been used as a graft or as a dressing in ocular surface reconstruction, facilitating epithelization, maintaining normal epithelial phenotype, and reducing inflammation, vascularization, and scarring. The corneal transparency is due, at least in part, to the arrangement in orthogonal lamellae of collagen fibrils, surrounded by proteoglycans (PGs). These PGs regulate fibrilogenesis, the matrix assembly, and ultimately the corneal transparency. The purpose of the present study was to investigate the effects of AMT upon the corneal PGs after severe limbal injury.METHODS. Experiments were performed on the right corneas of 22 New Zealand female albino rabbits, and their left corneas were used as matched controls. These animals were divided into 3 groups: G1 (n = 10): total peritomy and keratolimbectomy, followed by application of 0.5 M NaOH; G2 (n = 10): submitted to the same trauma as G1, and treated by AMT; G3: no trauma, only AMT (n = 2). The right corneas of G2 and G3 were covered by DMSO 4 cryopreserved human amniotic membrane, fixed by interrupted 9-0 mononylon sutures, with its stromal face toward the ocular surface. After 7 or 30 days, the corneas were removed and PGs were extracted.RESULTS. Normal corneas contained approximately 9 mg of PGs per gram of dry tissue. AMT on intact cornea (G3) did not cause any changes in the concentration of PGs. In contrast, injured corneas contained much less PGs, both on the seventh and on the 30th day posttrauma. The PG concentration was even lower in injured corneas treated by AMT. This decrease was due almost exclusively to dermatan sulfate PGs, and the structure of dermatan sulfate was also modified, indicating changes in the biosynthesis patterns.CONCLUSIONS. Although beneficial effects have been observed on clinical observation and concentration of soluble proteins after AMT, the normal PG composition of cornea was not attained, even 30 days postinjury, indicating that the normal ocular surface reconstruction, if possible, is a long-term process. (Eur J Ophthalmol 2010; 20: 290-9)
Resumo:
Trans-dehydrocrotonin, the major diterpene isolated from the bark of Croton cajucara, has good antiulcerogenic activity which, however, is accompanied by toxic effects. on the basis of these results, a semi-synthetic crotonin, named 4SRC, was prepared to determine whether this substance has similar antiulcerogenic activity with lower or no toxicity. The natural crotonin was also isolated from the bark of C. cajucara but was not used due to the small amount obtained. The cytotoxic effect of semi-synthetic crotonin, expressed as cell viability, was assessed in (a) lung fibroblast cell line (V79) derived from Chinese hamsters, a system commonly used for cytotoxicity studies, and (b) rat hepatocytes isolated from male Wistar rats. After treatment, cell viability was determined by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide reduction (MTT reduction), total acid content and neutral red uptake assays. To evaluate V79 cell viability, different concentrations of semi-synthetic crotonin were incubated with the cells. To evaluate the antiulcerogenic effects of semi-synthetic crotonin (50, 100 and 200 mg/kg), we used the models of gastric ulcer induced by ethanol/HCl, stress, indomethacin/bethanechol, and ethanol in male Swiss mice and male Wistar rats. The substance had an IC50 = 500 muM in the neutral red uptake and MTT reduction tests and an IC50 = 200 muM in the nucleic acid content test. With regard to hepatocyte viability after treatment with semi-synthetic crotonin at different concentrations, semi-synthetic crotonin had an IC50 = 10-500 muM in the nucleic acid content and MTT reduction tests and an IC50 = 120 muM in the neutral red uptake test. In another experiment, V79 cells were incubated with the metabolites produced by hepatocytes treated with different concentrations of semi-synthetic crotonin. After a 4-h incubation, semi-synthetic crotonin had an IC50 = 500 muM in the MTT reduction and neutral red uptake tests and an IC50 = 370 muM in nucleic acid content test. The substance had significant antiulcerogenic activity in all models studied, suggesting the presence of a possible antisecretory effect combined with a cytoprotective effect. For this reason, the effect of semi-synthetic crotonin was also evaluated on biochemical parameters of gastric juice and gastric wall mucus, both obtained from pylorus-ligated mice. No significant differences were observed in these parameters between semi-synthetic crotonin-treated and control animals. The results obtained with semi-synthetic crotonin are promising, with a significant preventive effect against gastric ulcer induced by different agents. Our data also show that semi-synthetic crotonin was less toxic than dehydrocrotonin and that the cytotoxic effects decreases with the time that isolated hepatocytes were in culture. (C) 2003 Elsevier B.V. B.V. All rights reserved.