Selênio em tilápia do Nilo utilizando eletroforese em gel e espectrometria atômica

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Perfil da eletroforese das proteínas urinárias de gestantes hipertensas

Pós-graduação em Ginecologia, Obstetrícia e Mastologia - FMB

Localização da proteína fosfolipase C zeta em extratos esppermáticos de gatos domésticos normospérmicos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Proteinograma do líquido sinovial de equinos hígidosobtido por eletroforese em gel de poliacrilamida

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Aproximações: eu e meus pares : considerações sobre a produção bidimensional e tridimensional

Não disponível

Crises de fronteira e estruturas complexas no espaço de parâmetros em um mapeamento dissipativo bidimensional

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Análise comparativa de características seminais de Mazama cinzas brasileiros: morfometria espermática e proteômica do plasma seminal

Pós-graduação em Medicina Veterinária - FCAV

Análise comparativa dos resultados obtidos pelos métodos de calibração de campo tridimensional e bidimensional

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Eletroforese das proteínas séricas e urinárias de cães com erliquiose subclínica

Pós-graduação em Medicina Veterinária - FCAV

Eletroforese das proteínas séricas e urinárias de cães com erliquiose na fase aguda

Pós-graduação em Medicina Veterinária - FCAV

Desenvolvimento de método por cromatografia líquida bidimensional abrange para documentação química de extratos vegetais e estudos metabolômicos

Pós-graduação em Química - IQ

Caracterização de filmes de BaxSr1-xTiO3 Sintetizados pelo método hidrotermal assistido por micro-ondas e depositados por eletroforese

Pós-graduação em Ciência e Tecnologia de Materiais - FC

Termodinâmica de um conjunto de partículas em um bilhar bidimensional dependente do tempo: um gás bidimensional simplificado

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Semiparametric modeling of the spatial distribution of occupational accident risk in the casual labor market, Piracicaba, southeast Brazil

The objective of this study was to estimate the spatial distribution of work accident risk in the informal work market in the urban zone of an industrialized city in southeast Brazil and to examine concomitant effects of age, gender, and type of occupation after controlling for spatial risk variation. The basic methodology adopted was that of a population-based case-control study with particular interest focused on the spatial location of work. Cases were all casual workers in the city suffering work accidents during a one-year period; controls were selected from the source population of casual laborers by systematic random sampling of urban homes. The spatial distribution of work accidents was estimated via a semiparametric generalized additive model with a nonparametric bidimensional spline of the geographical coordinates of cases and controls as the nonlinear spatial component, and including age, gender, and occupation as linear predictive variables in the parametric component. We analyzed 1,918 cases and 2,245 controls between 1/11/2003 and 31/10/2004 in Piracicaba, Brazil. Areas of significantly high and low accident risk were identified in relation to mean risk in the study region (p < 0.01). Work accident risk for informal workers varied significantly in the study area. Significant age, gender, and occupational group effects on accident risk were identified after correcting for this spatial variation. A good understanding of high-risk groups and high-risk regions underpins the formulation of hypotheses concerning accident causality and the development of effective public accident prevention policies.