Efeito simultâneo da deficiência hídrica e do alumínio tóxico no solo na cultivar IAC91-5155 de cana-de-açúcar

Sugarcane is a very important economic crop in Brazil. The effects of abiotic stresses cause negative reduction of the productivity in the sugarcane industry. In order to identify indicators of stresses tolerance, two physiological variables were evaluated, nitrate reductase activity and chlorophyll contents in young plants of sugarcane, cv. IAC91-5155. The simultaneous effect of abiotic stresses of high occurrence in Brazilian soils are, water deficiency and aluminum toxicity. The plants were submitted to three treatments of water availability (% field capacity, FC): no stress (70% FC), moderate stress (55% FC), and extreme stress (40% FC); and three acidity treatments in the soil (base saturation, V%): no acidity (V=55%), average acidity (V=33%), and high acidity (V=23%). The experiment was carried out in greenhouse, with 29.7 +/- 4.3 degrees C and 75 +/- 10% RH. The experimental design was in randomized blocks, in 3x3 factorial arrangement, with four replicates. After 60 days, nitrate reductase activity and chlorophyll contents were evaluated in the diagnostic leaf. The results demonstrate that the response of plants to a combination of drought and aluminum toxicity, similar to the conditions in many natural environments, is different from the response of plants to each of these stresses applied individually, as typically tested in the laboratory. The nitrate reductase activity can be used as a biochemical-physiological marker of water deficiency while chlorophyll contents can be used as a biochemical-physiological marker of both of them, water deficiency or aluminum toxicity in soil. Both parameters can not be as a biochemical-physiological marker for acclimation of young plants of sugarcane cv. IAC91-5155, under the combined stresses.

Preliminary study on age- and sex-dependent alterations in the composition of skeletal muscle fibers of Brasileiro de Hipismo horses

The aim of this work was to characterize the distribution of myofibers in the gluteus medius muscle of inactive horses of the Brasileiro de Hipismo (BH) breed at different ages by means of histochemical analyses, according to sex and depth of the biopsy. A total of 78 inactive horses (9 castrated males, 35 stallions, and 34 females) of the BH breed, aged 1 to 4 years, were used. A percutaneous muscle biopsy was obtained with a 6.0-mm Bergstrom-type needle, which allowed the removal of muscle fragments at depths of 20 and 60 mm. Myofiber types were determined based on myofibrillar adenosine triphosphatase (mATPase) and nicotinamide dinucleotide tetrazolium reductase (NADH-TR) techniques. Morphometry of the fibers was determined based on cross-sectional area (CSA), mean frequency (F), and relative cross-sectional area (RCSA). The current study demonstrated that BH horses 3 and 4 years of age show a greater percentage of, and area occupied by, type IIA fibers and lower percentage of type IIX fibers in the gluteus medius muscle compared with horses 1 and 2 years of age. No difference was found between sexes in the frequency of and area occupied by the different fiber types at any of the depths and ages studied. In this study, females showed a greater CSA for all fibers in comparison with males, at 1 year of age. The results of the current study indicate that the gluteus medius muscle of inactive BH horses shows modifications in its structural and biochemical composition during the growth of the animals, leading to a better oxidative capacity.

Vitrification with DAP 213 and Cryotop of Ex Situ and In Situ Feline Cumulus-Oocyte Complexes

This study was undertaken to compare cryotolerance, in terms of viability and resumption of meiosis after warming and culture (24 and 48 h), of ex situ (isolated) and in situ (enclosed in the ovarian tissue) feline cumulusoocyte complexes (COCs) vitrified with DAP 213 (2 M DMSO, 1 M acetamide, 3 M propylene glycol) in cryotubes or Cryotop method. Ovaries were harvested from 49 pubertal queens. of each pair of ovaries, one was dissected to release COCs randomly divided into three groups: fresh COCs (control), ex situ COCs vitrified with DAP 213 and Cryotop. The cortex of the other ovary was sectioned into small fragments (approximately 1.5 mm3) and randomly assigned to be vitrified by DAP 213 or Cryotop. After warming, ex situ and in situ (retrieved form vitrified ovarian tissue) COCs were matured in vitro. Viability of oocytes was highly preserved after warming and culture in all treatments. Proportions of oocytes surrounded by complete layers of viable cumulus cells were remarkably decreased (p < 0.00001) in both vitrification procedures compared to fresh oocytes. Resumption of meiosis occurred in all treatments. After 24 h of culture, results were similar in ex situ and in situ vitrified oocytes regardless of the vitrification protocol used (range 29-40%), albeit lower (p < 0.05) than those of fresh oocytes (65.8%). After 48 h of culture, ex situ oocytes vitrified with Cryotop achieved the rates of meiosis resumption similar to fresh oocytes (53.8% vs 67.5%; p > 0.05) and ex situ and in situ oocytes vitrified with DAP 213 showed similar rates of resumption of meiosis. These findings demonstrated that DAP 213 and Cryotop preserve the viability of ex situ and in situ oocytes, but cumulus cells are highly susceptible to vitrification. However, the capability to resume meiosis evidences that feline immature oocytes vitrified as isolated or enclosed in the ovarian cortex have comparable cryotolerance.

Light exercise causes adaptive changes in muscles of young Brasileiro de Hipismo horses

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Non-destructive determination of photosynthetic pigments in the leaves of castor oil plants

Objetivou-se com o presente trabalho, estabelecer a relação entre os pigmentos fotossintéticos extraídos em DMSO e as leituras obtidas no clorofilômetro portátil ClorofiLOG® 1030, gerando modelos matemáticos capazes de predizer os teores de clorofila e de carotenóides em folhas de mamoneira. O trabalho foi conduzido na Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA) Algodão, situada em Campina Grande, Estado da Paraíba, em outubro de 2010. Para a análise indireta, foi utilizado um equipamento portátil, sendo realizada a leitura em discos foliares com diferentes tonalidades de verde, sendo feita, nesses mesmos discos, a determinação da clorofila pelo método clássico. Para a extração da clorofila, utilizaram-se 5 mL de dimetilsulfóxido (DMSO), a qual foi mantida em banho-maria a 70ºC, por 30 minutos, e retirou-se 3 mL da alíquota para leitura em espectrofotômetro nos comprimentos de onda de 470, 646 e 663 nm. Os dados foram submetidos à análise da variância e regressão polinomial. A leitura obtida no clorofilômetro portátil foi a variável dependente, e os pigmentos fotossintéticos determinados pelo método clássico foi a variável independente. Os resultados indicaram que o clorofilômetro portátil ClorofiLOG® 1030, associado a modelos matemáticos, permitiu estimar a concentração dos pigmentos fotossintéticos, exceto a clorofila b, com alta precisão, com economia de tempo e com reagentes normalmente utilizados nos procedimentos convencionais.

Effects of Statin and Aerobic Physical Exercise Association in the Cardiomyocytes of the Rat. Morphometric Study

Physical exercise and statins, recommended interventions to dyslipidaemia treatment, are independently related to cardiomyocytes alterations, characterized by miocardic hypertrophy and apoptosis, respectively. Thus, the objective of the present study was to analyze the effects of statin and aerobic physical exercise association in the morphometric parameters of cardiac cell nucleus. 40 male rats adults were divided into four groups: exercised (DE); sedentary (DS), exercised and statin use (DES); sedentary and statin use (DSS). The animals received during the whole experimental period a hiperlipidic diet added 20% of coconut oil and 1.25% of cholesterol; after 30 days of its ingestion, a blood collection was made to verify the dyslipidaemia. Simvastatin (20 mg) was taken five days a week, during eight weeks. During this period, the animals exercised 60 minutes daily in the treadmill. After the last day of the protocol, the cardiac muscle was collected and maintained in liquid nitrogen (-180 degrees C); the cuts were stained by Hematoxilin-Eosin method, and the cardiac fibers were submitted to the nuclear morphometric analyses. The data were analyzed using descriptive analyses, paired T test, Kruskal-Wallis test and Dunn post hoc test; for all analyses, it was adopted p<0.05. It was verified that the group receiving statin presented values statistically significant in comparison to the other groups, in the tridimensional and linear variables. The exercised and statin group, the values obtained in the morphometric analyses were similar to the control group. It is suggested that statins alone can cause alterations in the nucleus of cardiac cells that can be related to apoptosis occurrence and, when exercise is practiced associated to statin administration, the effects of statin can be reduced, what can be related to beneficial adaptations of cardiac mitochondrial in response to physical exercise, turning them more resistant to apoptotic stimuli.

Muscle response to the association of statin and physical exercise in rats

Physical exercise and statins, which are recommended for the treatment of dyslipidemia, are independently associated to the occurrence of muscle injury. The objective is analyze the effect of aerobic exercise associated to the use of simvastatin on the morphology of the gastrocnemius muscle. Thirty Wistar rats were divided into six groups, two of which received a standard diet (1 sedentary and 1 exercised) and four (1 sedentary with medication, 1 sedentary without medication, 1 exercised with medication, 1 exercised without medication) received a hypercholesterolemic diet (standard diet with the addition of cholesterol and coconut oil). Simvastatin (20 mg/Kg) was administered five days a week for eight weeks, together with aerobic training on a treadmill (9.75 m/min) for 60 minutes a day. The gastrocnemius muscle was removed, sliced, stained with Hematoxylin-Eosin and submitted to a histochemical reaction to determine mitochondrial activity. The data were analyzed using a paired t-test, analysis of variance and Scheffe's post hoc test (p<0.05). Greater histological alterations were found in the medicated and exercised animals, with a greater frequency of occurrence as well. The histochemical analysis revealed that the medicated groups had fibers with more intensive mitochondrial activity alongside fibers with an absence of reaction. The morphometric analysis revealed no significant differences between groups. It is suggested that simvastatin is a medication that leads to the occurrence of muscle injury and its administration in association with physical activity may exacerbate these injuries. This finding may be related to cellular respiration.

Efeito do exercício físico e estatinas na função muscular em animais com dislipidemia

As estatinas são utilizadas no tratamento das dislipidemias, com grande tolerância; no entanto, vários efeitos colaterais podem surgir, destacando-se miopatia. A prática regular do exercício físico (EF) produz modificações favoráveis no perfil lipídico; entretanto, pode gerar lesões musculares. OBJETIVO: Avaliar o efeito da associação entre exercício físico e estatinas na função muscular, pela análise histológica, em modelo experimental animal com dislipidemia. MÉTODOS: Foram utilizados 80 ratos machos Wistar, distribuídos em oito grupos, incluindo animais submetidos à dieta hipercolesterolêmica (DH), sinvastatina com (G1) e sem (G2) EF; DH e fluvastatina, com (G3) e sem EF (G4); alimentados com ração comercial (RC) na presença (G5) e ausência de (G6) EF; DH submetidos (G7) ou não (G8) a EF. A DH foi administrada por 90 dias, as estatinas e prática de EF em esteira rolante por oito semanas. Os animais foram sacrificados, e o músculo sóleo retirado para análise histológica. Aplicaram-se os testes t de Student pareado e análise multivariada, com nível significante para p < 0,05. RESULTADOS: As principais alterações histológicas encontradas foram fibras de diferentes diâmetros, atróficas, em degeneração, splitting, edema, infiltrado inflamatório. Essas alterações foram observadas em 90% dos animais do grupo G1, 80% do G2, 70% do G3, 30% do G4, 40% do G5 e 30% do G7. Nos grupos G6 e G8 identificaram-se fibras musculares com morfologia preservada. CONCLUSÕES: Na avaliação histológica muscular, a associação entre fluvastatina, sinvastatina e exercício físico acarreta alterações morfológicas com predomínio no uso da sinvastatina, variando de grau leve a grave, no músculo sóleo de ratos, induzidos pelos inibidores da HMG-CoA redutase.

Diagnosis of Smith-Lemli-Opitz syndrome by ultraviolet spectrophotometry

Smith-Lemli-Opitz syndrome (SLOS) is an autosomal recessive disorder due to an inborn error of cholesterol metabolism, characterized by congenital malformations, dysmorphism of multiple organs, mental retardation and delayed neuropsychomotor development resulting from cholesterol biosynthesis deficiency. A defect in 3ß-hydroxysteroid-delta7-reductase (delta7-sterol-reductase), responsible for the conversion of 7-dehydrocholesterol (7-DHC) to cholesterol, causes an increase in 7-DHC and frequently reduces plasma cholesterol levels. The clinical diagnosis of SLOS cannot always be conclusive because of the remarkable variability of clinical expression of the disorder. Thus, confirmation by the measurement of plasma 7-DHC levels is needed. In the present study, we used a simple, fast, and selective method based on ultraviolet spectrophotometry to measure 7-DHC in order to diagnose SLOS. 7-DHC was extracted serially from 200 µl plasma with ethanol and n-hexane and the absorbance at 234 and 282 nm was determined. The method was applied to negative control plasma samples from 23 normal individuals and from 6 cases of suspected SLOS. The method was adequate and reliable and 2 SLOS cases were diagnosed.

Smith-Lemli-Opitz syndrome: clinical and biochemical findings in Brazilian patients

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Cruzain inhibition by hydroxymethylnitrofurazone and nitrofurazone: investigation of a new target in Trypanosoma cruzi

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Anxiolytic-like effects of erythrinian alkaloids from erythrina suberosa

Two alkaloids, erysodine (1) and erysothrine (2) were isolated from the flowers of a Pakistani medicinal plant, Erythrina suberosa. These compounds were investigated for anxiolytic properties, and the results showed significant effect, in an acute oral treatment with 1-2, which were suspended in saline (NaCl 0.9%) plus DMSO 1%, and evaluated in 122 Swiss male mice exposed to two tests of anxiety - the elevated plus-maze (EPM) and the light/dark transition model (LDTM).

Avaliação do polimorfismo no gene da metilenotetrahidrofolato redutase e concentração de folato e vitamina B12 em pacientes portadores do HIV-1 em tratamento com anti-retrovirais

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Electrochemical evidence of sulfinic acid derivative as an intermediate in the reduction of aromatic sulfonyl chloride in an aprotic medium

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)