133 resultados para mRNA poly(A) tail


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Local anesthetic agents cause temporary blockade of nerve impulses productiong insensitivity to painful stimuli in the area supplied by that nerve. Bupivacaine (BVC) is an amide-type local anesthetic widely used in surgery and obstetrics for sustained peripheral and central nerve blockade. in this study, we prepared and characterized nanosphere formulations containing BVC. To achieve these goals, BVC loaded poly(DL-lactide-co-glycolide) (PLGA) nanospheres (NS) were prepared by nanopreciptation and characterized with regard to size distribution, drug loading and cytotoxicity assays. The 2(3-1) factorial experimental design was used to study the influence of three different independent variables on nanoparticle drug loading. BVC was assayed by HPLC, the particle size and zeta potential were determined by dynamic light scattering. BVC was determined using a combined ultrafiltration-centrifugation technique. The results of optimized formulations showed a narrow size distribution with a polydispersivity of 0.05%, an average diameter of 236.7 +/- 2.6 nm and the zeta potential -2.93 +/- 1,10 mV. In toxicity studies with fibroblast 3T3 cells, BVC loaded-PLGA-NS increased cell viability, in comparison with the effect produced by free BVC. In this way, BVC-loaded PLGA-NS decreased BVC toxicity. The development of BVC formulations in carriers such as nanospheres could offer the possibility of controlling drug delivery in biological systems, prolonging the anesthetic effect and reducing toxicity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to investigate the hormonal regulation of the avian homolog of mammalian uncoupling protein (avUCP) by studying the impact of thyroid hormones and insulin on avUCP mRNA expression in chickens (Gallus gallus). For 3 wk, chicks received either a standard diet (control group), or a standard diet supplemented with triiodothyronine (T-3; T3 group) or with the thyroid gland inhibitor methimazole (MMI group). A fourth group received injections of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th wk of age, all animals received two daily injections of either human insulin or saline solution. The results indicate a twofold overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a clear downregulation (-74%) in MMI chickens compared with control chickens. Insulin injections had no significant effect on avUCP mRNA expression in chickens. This study describes for the first time induction of avUCP mRNA expression by the thermogenic hormone T3 in chickens and supports a possible involvement of avUCP in avian thermogenesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Four aliphatic thermoplastic poly(ester-urethane)s (PEUs) with similar molecular weights but varying polyesters molecular weight (534-1488 g/mol) were prepared from polyester diols, obtained by melt condensation of Azelaic acid and 1,9-Nonanediol, and 1,7-heptamethylene di-isocyanate (HPMDI) all sourced from vegetable oil feedstock. The thermal, and mechanical properties, and crystal structure of PEUs were investigated using DSC, TGA, DMA, tensile analysis and WAXD. For sufficiently long polyester chain, WAXD data indicated no hydrogen bonds polyethylene (PE)-like crystalline packing and for short polyester chains, small crystal domains with significant H-bonded polyamide (PA)-like packing. Crystallinity decreased with decreasing polyester molecular weights. The polymorphism of PEUs and consequently their melting characteristics were found to be largely controlled by polyester segment length. TGA of the PEUs indicated improved thermal stability with decreasing polyester chain length, suggesting a stabilization effect by urethane groups. Mechanical properties investigated by DMA and tensile analysis were found to scale predictably with the overall crystallinity of PEUs. (C) 2012 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Langmuir films have been fabricated from poly[(2-methoxy-5-n-hexyloxy)-p-phenylenevinylene] (OC1OC6-PPV). The stability and the area per monomer for condensed films indicate the formation of true monolayers with a very small extent of aggregation, which is unusual for polymer films. This is attributed to the linearity of the alkyl side chain. The Y-type Langmuir-Blodgett (LB) films produced from Langmuir films of OC1OC6-PPV have distinctive features compared to those of cast films, probably due to the organization in the LB films whereas the molecules are randomly oriented in cast films. Infrared absorption spectra recorded for both transmission and reflection modes indicate that OC1OC6-PPV molecules are anchored to the substrate by the lateral groups. This is confirmed by the Raman spectrum, in which a distortion of the vinylene group was observed, and by surface enhanced fluorescence (SEF) on an LB monolayer deposited onto Ag nanoparticles. The more homogeneous nature of the LB films in comparison with the case of cast films was demonstrated by optical microscopy and fluorescence measurements where the emission spectra were essentially the same for different regions of an LB film but showed dispersion in cast films. The LB films also displayed reversible photoconductivity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Blend films of poly (o-ethoxyaniline) (POEA) and collagen were fabricated by casting under optimized conditions and characterized by Raman scattering and UV-vis absorption spectroscopies. The UV-vis spectra showed that the addition of collagen in the aqueous solution of POEA promotes a dedoping of the POEA. This effect was also observed for the blend films as supported by Raman scattering and a mechanism for the chemical interaction between POEA-collagen is proposed. The influences of different percentage of collagen as well as the pH of stock solutions during the fabrication process of the blend films were also investigated. It was found that the preparation method plays an important role in the flexibility and freestanding properties of the films. Complementary, the surface morphology was studied by atomic force microscopy and the conductivity by dc measurements. (C) 2003 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Poly(styrene-co-methyl methacrylate) (PS-PMMA) ionomers with several degrees of sulfonation were synthesized and characterized by infrared, UV-vis, and NMR spectroscopies, elemental analysis, and differential scanning calorimetry (DSC). Stable Langmuir films could be produced with PS-PMMA with 3 and 6 mol % of sulfonation, while PS-PMMA 8% exhibited material loss to the water subphase, probably due to its higher solubility. Surface pressure and surface potential isotherms with PS-PMMA 3% spread onto salt-containing subphases pointed to a film behavior characteristic of the polyelectrolyte effect, where charge repulsion governs the film properties. The Langmuir-Blodgett films of this ionomer were successfully transferred onto various substrates, as confirmed by UV-vis and FTIR spectroscopies. Using cycling voltammetry, we show that LB films from PS-PMMA 3% can be applied in selective sensing of dopamine, even in the presence of interferents such as ascorbic acid.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A PPV derivative, poly(2-methoxy,5-(n-octadecyl)-p-phenylenevinylene) (OC1OC18-PPV), has been synthesized via the Gilch route and used to fabricate Langmuir and Langmuir-Blodgett (LB) films. True monomolecular films were formed at the air/water interface, which were successfully transferred onto different types of substrate. Using UV-visible absorption, FTIR, fluorescence and Raman scattering spectroscopies we observed that the polymer molecules were randomly distributed in the LB film, with no detectable anisotropy. This is in contrast to the anisotropic LB films of a previously reported PPV derivative, poly(2-methoxy-5-n-hexyloxy)-p-phenylenevinylene (OC1OC6-PPV), which is surprising because the longer chain of OC1OC18-PPV investigated here was expected to lead to more ordered films. As a consequence of the lack of order, LB films of OC1OC18-PPV exhibit lower photoconductivity and require higher operating voltage in a polymer light-emitting diode (PLED) in comparison with LB films of OC1OC6-PPV. This result confirms the importance of molecular organization in the LB film to obtain efficient PLEDs. (c) 2005 Elsevier Ltd. All rights reserved.