205 resultados para PCR Arrays
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Biotecnologia - IQ
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Pós-graduação em Doenças Tropicais - FMB
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Sparse arrays have pitch larger than half-wavelength (lambda/2) and there is a reduced number of elements in comparison with a full-populated array. Consequently, there is a reduction in cost, data acquisition and processing. However, conventional beamforming techniques result in large side and grating lobes, and consequently in image artifacts. In this work the instantaneous phase of the signals is used in a beamforming technique instead of the instantaneous amplitudes to improve images obtained from sparse arrays configurations. A threshold based on a statistical analysis and the number of signals used for imaging is applied to each pixel, in order to determine if that pixel is related to a defect or not. Three sets of data are used to evaluate the technique, considering medical and non-destructive testing: a simulated point spread function, a medical phantom and an aluminum plate with 2 lambda-, 7 lambda- and lambda-pitch, respectively. The conventional amplitude image is superposed by the image improved by the instantaneous phase, increasing the reflectors detectability and reducing artifacts for all cases, as well as dead zone for the tested plate.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Visceral leishmaniasis (VL), also known as kala-azar, is a disseminated protozoan infection caused by Leishmania donovani complex. Traditionally the definite diagnosis is made by amastigote detection in the tissue. The aim this study was to evaluate the PCR technique in stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis. Slides were selected totaling 62 suspect cases (33 bone marrow samples and 29 lymph node samples) and 17 positive cases (8 bone marrow and 9 lymph node). From 62 suspect cases, 39 (62.90%) were confirmed to be positive being 17 (n = 29) lymph node aspirates and 22 (n = 33) bone marrow. This finding is in agreement with the higher sensitivity of the PCR assay compared to direct microscopic observation. In conclusion, the findings of this study supports the use of PCR on archive cytological preparation stained slides for the diagnosis of canine visceral leishmaniasis, emphasizing the higher sensitivity of this technique when compared to direct microscopic examination and mostly the use of the suspect status for the cytology samples that presents the previously mentioned particularities with focus on detecting the oligosymptomatic or assymptomatic dogs in endemic areas functioning as potential reservoirs for this disease. (C) 2014 Elsevier B.V. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)