53 resultados para mRNA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to investigate the hormonal regulation of the avian homolog of mammalian uncoupling protein (avUCP) by studying the impact of thyroid hormones and insulin on avUCP mRNA expression in chickens (Gallus gallus). For 3 wk, chicks received either a standard diet (control group), or a standard diet supplemented with triiodothyronine (T-3; T3 group) or with the thyroid gland inhibitor methimazole (MMI group). A fourth group received injections of the deiodinase inhibitor iopanoic acid (IOP group). During the 4th wk of age, all animals received two daily injections of either human insulin or saline solution. The results indicate a twofold overexpression of avUCP mRNA in gastrocnemius muscle of T3 birds and a clear downregulation (-74%) in MMI chickens compared with control chickens. Insulin injections had no significant effect on avUCP mRNA expression in chickens. This study describes for the first time induction of avUCP mRNA expression by the thermogenic hormone T3 in chickens and supports a possible involvement of avUCP in avian thermogenesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nuclear poly(A)-binding protein 1 (PABPN1) is a ubiquitously expressed protein that plays a critical role in polyadenylation. Short expansions of the polyalanine tract in the N-terminus of PABPN1 lead to oculopharyngeal muscular dystrophy (OPMD), which is an adult onset disease characterized by eyelid drooping, difficulty in swallowing and weakness in the proximal limb muscles. Although significant data from in vitro biochemical assays define the function of PABPN1 in control of poly(A) tail length, little is known about the role of PABPN1 in mammalian cells. To assess the function of PABPN1 in mammalian cells and specifically in cells affected in OPMD, we examined the effects of PABPN1 depletion using siRNA in primary mouse myoblasts from extraocular, pharyngeal and limb muscles. PABPN1 knockdown significantly decreased cell proliferation and myoblast differentiation during myogenesis in vitro. At the molecular level, PABPN1 depletion in myoblasts led to a shortening of mRNA poly(A) tails, demonstrating the cellular function of PABPN1 in polyadenylation control in a mammalian cell. In addition, PABPN1 depletion caused nuclear accumulation of poly(A) RNA, revealing that PABPN1 is required for proper poly(A) RNA export from the nucleus. Together, these experiments demonstrate that PABPN1 plays an essential role in myoblast proliferation and differentiation, suggesting that it is required for muscle regeneration and maintenance in vivo.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

mRNA stability is modulated by elements in the mRNA transcript and their cognate RNA binding proteins. Poly(U) binding protein 1 (Pub1) is a cytoplasmic Saccharomyces cerevisiae mRNA binding protein that stabilizes transcripts containing AU-rich elements (AREs) or stabilizer elements (STEs). In a yeast two-hybrid screen, we identified nuclear poly(A) binding protein 2 (Nab2) as being a Pub1-interacting protein. Nab2 is an essential nucleocytoplasmic shuttling mRNA binding protein that regulates poly(A) tail length and mRNA export. The interaction between Pub1 and Nab2 was confirmed by copurification and in vitro binding assays. The interaction is mediated by the Nab2 zinc finger domain. Analysis of the functional link between these proteins reveals that Nab2, like Pub1, can modulate the stability of specific mRNA transcripts. The half-life of the RPS16B transcript, an ARE-like sequence-containing Pub1 target, is decreased in both nab2-1 and nab2-67 mutants. In contrast, GCN4, an STE-containing Pub1 target, is not affected. Similar results were obtained for other ARE- and STE-containing Pub1 target transcripts. Further analysis reveals that the ARE-like sequence is necessary for Nab2-mediated transcript stabilization. These results suggest that Nab2 functions together with Pub1 to modulate mRNA stability and strengthen a model where nuclear events are coupled to the control of mRNA turnover in the cytoplasm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Augmented glucose-stimulated insulin secretion (GSIS) is an adaptive mechanism exhibited by pancreatic islets from insulin-resistant animal models. Gap junction proteins have been proposed to contribute to islet function. As such, we investigated the expression of connexin 36 (Cx36), connexin 43 (Cx43), and the glucose transporter Glut2 at mRNA and protein levels in pancreatic islets of dexamethasone (DEX)-induced insulin-resistant rats. Study rats received daily injections of DEX (1 mg/kg body mass, i.p.) for 5 days, whereas control rats (CTL) received saline solution. DEX rats exhibited peripheral insulin resistance, as indicated by the significant postabsorptive insulin levels and by the constant rate for glucose disappearance (K-ITT). GSIS was significantly higher in DEX islets (1.8-fold in 16.7 mmol/L glucose vs. CTL, p < 0.05). A significant increase of 2.25-fold in islet area was observed in DEX vs. CTL islets (p < 0.05). Cx36 mRNA expression was significantly augmented, Cx43 diminished, and Glut2 mRNA was unaltered in islets of DEX vs. CTL (p < 0.05). Cx36 protein expression was 1.6-fold higher than that of CTL islets (p < 0.05). Glut2 protein expression was unaltered and Cx43 was not detected at the protein level. We conclude that DEX-induced insulin resistance is accompanied by increased GSIS and this may be associated with increase of Cx36 protein expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)