Proliferative and anti-proliferative effects of titanium- and iron-based metallocene anti-cancer drugs

In previous work we have found that Cp2TiCl2 and its corresponding deriv. of tamoxifen, Titanocene tamoxifen, show an unexpected proliferative effect on hormone dependent breast cancer cells MCF-7. In order to check if this behavior is a general trend for titanocene derivs. we have tested two other titanocene derivs., Titanocene Y and Titanocene K, on this cell line. Interestingly, these two titanocene complexes behave in a totally different manner. Titanocene K is highly proliferative on MCF-7 cells even at low concns. (0.5 .mu.M), thus behave almost similarly to Cp2TiCl2. This proliferative effect is also obsd. in the presence of bovine serum albumin (BSA). In contrast, Titanocene Y alone has almost no effect on MCF-7 at a concn. of 10 .mu.M, but exhibits a significant dose dependent cytotoxic effect of up to 50% when incubated with BSA (20-50 .mu.g/mL). This confirms the crucial role played by the binding to serum proteins in the expression of the in vivo, cytotoxicity of the titanocene complexes. From the hydridolithiation reaction of 6-p-anisylfulvene with LiBEt3H followed by transmetallation with iron dichloride [bis-[(p-methoxy-benzyl)cyclopentadienyl]iron(II)] (Ferrocene Y) was synthesized. This complex, which was characterized by single crystal X-ray diffraction, contains the robust ferrocenyl unit instead of Ti assocd. with easily leaving groups such as chlorine and shows only a modest cytotoxicity against MCF-7 or MDA-MB-231 cells.

Molecular structures of benzoic acid and 2-hydroxybenzoic acid, obtained by gas-phase electron diffraction and theoretical calculations

The structures of benzoic acid (C6H5COOH) and 2-hydroxybenzoic acid (C6H4OHCOOH) have been determined in the gas phase by electron diffraction using results from quantum chemical calculations to inform restraints used on the structural parameters. Theoretical methods (HF and MP2/6-311+G(d, p)) predict two conformers for benzoic acid, one which is 25.0 kJ mol(-1) (MP2) lower in energy than the other. In the low-energy form, the carboxyl group is coplanar with the phenyl ring and the O-H group eclipses the C=O bond. Theoretical calculations (HF and MP2/6-311+ G(d, p)) carried out for 2-hydroxybenzoic acid gave evidence for seven stable conformers but one low-energy form (11.7 kJ mol-1 lower in energy (MP2)) which again has the carboxyl group coplanar with the phenyl ring, the O-H of the carboxyl group eclipsing the C=O bond and the C=O of the carboxyl group oriented toward the O-H group of the phenyl ring. The effects of internal hydrogen bonding in 2-hydroxybenzoic acid can be clearly observed by comparison of pertinent structural parameters between the two compounds. These differences for 2-hydroxybenzoic acid include a shorter exocyclic C-C bond, a lengthening of the ring C-C bond between the substituents, and a shortening of the carboxylic single C-O bond.

Molecular structures of 3-hydroxybenzoic acid and 4-hydroxybenzoic acid, obtained by gas-phase electron diffraction and theoretical calculations

The structures of 3-hydroxybenzoic acid and 4-hydroxybenzoic acid have been determined by gas-phase electron diffraction using results from quantum chemical calculations to inform the choice of restraints applied to some of the structural parameters. The results from the study presented here demonstrate that resonance hybrids are not as helpful in rationalizing the structures of 2-, 3-, and 4-hydroxybenzoic acids as are models based upon electrostatic effects.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Steric effects on uranyl complexation: synthetic, structural, and theoretical studies of carbamoyl pyrazole compounds of the uranyl(VI) ion

New bifunctional pyrazole based ligands of the type [C3HR2N2CONR'] (where R = H or CH3; R' = CH3, C2H5, or (C3H7)-C-i) were prepared and characterized. The coordination chemistry of these ligands with uranyl nitrate and uranyl bis(dibenzoyl methanate) was studied with infrared (IR), H-1 NMR, electrospray-mass spectrometry (ES-MS), elemental analysis, and single crystal X-ray diffraction methods. The structure of compound [UO2(NO3)(2)(C3H3N2CON{C2H5}(2))] (2) shows that the uranium(VI) ion is surrounded by one nitrogen atom and seven oxygen atoms in a hexagonal bipyramidal geometry with the ligand acting as a bidentate chelating ligand and bonds through both the carbamoyl oxygen and pyrazolyl nitrogen atoms. In the structure of [UO2(NO3)(2)(H2O)(2)(C5H7N2CON {C2H5}(2))(2)], (5) the pyrazole figand acts as a second sphere ligand and hydrogen bonds to the water molecules through carbamoyl oxygen and pyrazolyl nitrogen atoms. The structure of [UO2(DBM)(2)C3H3N2CON{C2H5}(2)] (8) (where DBM = C6H5COCHCOC6H5) shows that the pyrazole ligand acts as a monodentate ligand and bonds through the carbamoyl oxygen to the uranyl group. The ES-MS spectra of 2 and 8 show that the ligand is similarly bonded to the metal ion in solution. Ab initio quantum chemical studies show that the steric effect plays the key role in complexation behavior.