Detection of transgenic and endogenous plant DNA fragments in the blood, tissues, and digesta of broilers

The aim was to determine the fate of transgenic and endogenous plant DNA fragments in the blood, tissues, and digesta of broilers. Male broiler chicks (n = 24) were allocated at 1 day old to each of four treatment diets designated T1-T4. T1 and T2 contained the near isogenic nongenetically modified (GM) maize grain, whereas T3 and T4 contained GM maize grain [cry1a(b) gene]; T1 and T3 also contained the near isogenic non-GM soybean meal, whereas T2 and T4 contained GM soybean meal (cp4epsps gene). Four days prior to slaughter at 39-42 days old, 50% of the broilers on T2-T4 had the source(s) of GM ingredients replaced by their non-GM counterparts. Detection of specific DNA sequences in feed, tissue, and digesta samples was completed by polymerase chain reaction analysis. Seven primer pairs were used to amplify fragments (similar to 200 bp) from single copy genes (maize high mobility protein, soya lectin, and transgenes in the GM feeds) and multicopy genes (poultry mitochondrial cytochrome b, maize, and soya rubisco). There was no effect of treatment on the measured growth performance parameters. Except for a single detection of lectin (nontransgenic single copy gene; unsubstantiated) in the extracted DNA from one bursa tissue sample, there was no positive detection of any endogenous or transgenic single copy genes in either blood or tissue DNA samples. However, the multicopy rubisco gene was detected in a proportion of samples from all tissue types (23% of total across all tissues studied) and in low numbers in blood. Feed-derived DNA was found to survive complete degradation up to the large intestine. Transgenic DNA was detected in gizzard digesta but not in intestinal digesta 96 h after the last feeding of treatment diets containing a source of GM maize and/or soybean meal.

Detecting recombination in 4-taxa DNA sequence alignments with Bayesian hidden Markov models and Markov chain Monte Carlo

This article presents a statistical method for detecting recombination in DNA sequence alignments, which is based on combining two probabilistic graphical models: (1) a taxon graph (phylogenetic tree) representing the relationship between the taxa, and (2) a site graph (hidden Markov model) representing interactions between different sites in the DNA sequence alignments. We adopt a Bayesian approach and sample the parameters of the model from the posterior distribution with Markov chain Monte Carlo, using a Metropolis-Hastings and Gibbs-within-Gibbs scheme. The proposed method is tested on various synthetic and real-world DNA sequence alignments, and we compare its performance with the established detection methods RECPARS, PLATO, and TOPAL, as well as with two alternative parameter estimation schemes.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

DNA barcodes for Mexican Cactaceae, plants under pressure from wild collecting

DNA barcodes could be a useful tool for plant conservation. Of particular importance is the ability to identify unknown plant material, such as from customs seizures of illegally collected specimens. Mexican cacti are an example of a threatened group, under pressure because of wild collection for the xeriscaping trade and private collectors. Mexican cacti also provide a taxonomically and geographically coherent group with which to test DNA barcodes. Here, we sample the matK barcode for 528 species of Cactaceae including approximately 75% of Mexican species and test the utility of the matK region for species-level identification. We find that the matK DNA barcode can be used to identify uniquely 77% of species sampled, and 79-87% of species of particular conservation importance. However, this is far below the desired rate of 95% and there are significant issues for PCR amplification because of the variability of primer sites. Additionally, we test the nuclear ITS regions for the cactus subfamily Opuntioideae and for the genus Ariocarpus (subfamily Cactoideae). We observed higher rates of variation for ITS (86% unique for Opuntioideae sampled) but a much lower PCR success, encountering significant intra-individual polymorphism in Ariocarpus precluding the use of this marker in this taxon. We conclude that the matK region should provide useful information as a DNA barcode for Cactaceae if the problems with primers can be addressed, but matK alone is not sufficiently variable to achieve species-level identification. Additional complementary regions should be investigated as ITS is shown to be unsuitable

Analysis of DNA polymorphism in ancient barley herbarium material: validation of the KASP SNP genotyping platform

The availability of crop specimens archived in herbaria and old seed collections represent valuable resources for the analysis of plant genetic diversity and crop domestication. The ability to extract ancient DNA (aDNA) from such samples has recently allowed molecular genetic investigations to be undertaken in ancient materials. While analyses of aDNA initially focused on the use of markers which occur in multiple copies such as the internal transcribed spacer region (ITS) within ribosomal DNA and those requiring amplification of short DNA regions of variable length such as simple sequence repeats (SSRs), emphasis is now moving towards the genotyping of single nucleotide polymorphisms (SNPs), traditionally undertaken in aDNA by Sanger sequencing. Here, using a panel of barley aDNA samples previously surveyed by Sanger sequencing for putative causative SNPs within the flowering-time gene PPD-H1, we assess the utility of the Kompetitive Allele Specific PCR (KASP) genotyping platform for aDNA analysis. We find KASP to out-perform Sanger sequencing in the genotyping of aDNA samples (78% versus 61% success, respectively), as well as being robust to contamination. The small template size (≥46 bp) and one-step, closed-tube amplification/genotyping process make this platform ideally suited to the genotypic analysis of aDNA, a process which is often hampered by template DNA degradation and sample cross-contamination. Such attributes, as well as its flexibility of use and relatively low cost, make KASP particularly relevant to the genetic analysis of aDNA samples. Furthermore, KASP provides a common platform for the genotyping and analysis of corresponding SNPs in ancient, landrace and modern plant materials. The extended haplotype analysis of PPD-H1 undertaken here (allelic variation at which is thought to be important for the spread of domestication and local adaptation) provides further resolution to the previously identified geographic cline of flowering-time allele distribution, illustrating how KASP can be used to aid genetic analyses of aDNA from plant species. We further demonstrate the utility of KASP by genotyping ten additional genetic markers diagnostic for morphological traits in barley, shedding light on the phenotypic traits, alleles and allele combinations present in these unviable ancient specimens, as well as their geographic distributions.

Controlled dehydration of a ruthenium complex-DNA crystal induces reversible DNA kinking

Hydration-dependent DNA deformation has been known since Rosalind Franklin recognised that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fibre diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)]2+ (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyridophenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven datasets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.