45 resultados para DNA sequence representation
Resumo:
The DNA sequence of the chromosomal gene cluster encoding the SEF14 fimbriae of Salmonella enterica serovar Enteritidis was determined. Five contiguous open reading frames, sefABCDE, were identified. The sefE gene shared significant homology with araC-like positive regulators. Serovar-associated virulence plasmid (SAP) genes orf7,8,9 and pefI were identified immediately adjacent to the sef operon. The pefI gene encoded a putative regulator of the Plasmid-encoded fimbrial antigen (PEF) expression. The entire sef-pef region, Ranked by two IS-like elements, was inserted adjacent to leuX that encoded a transfer RNA molecule. The organisation of this region was suggestive of a classic pathogenicity islet. Southern hybridisation confirmed two copies of the SAP derived orf7,8,9 and pefI region in S. Enteritidis, one in the chromosome and one on the SAP. Of other group D Salmonella, only S. Blegdam and S. Moscow harboured both chromosomal and plasmid copies of pefI-orf9 region although polymorphism was evident. Crown Copyright (C) 2001 Published by Elsevier Science B.V. All rights reserved.
Resumo:
Denaturing high-performance liquid chromatography (DHPLC) was evaluated as a rapid screening and identification method for DNA sequence variation detection in the quinolone resistance-determining region of gyrA from Salmonella serovars. A total of 203 isolates of Salmonella were screened using this method. DHPLC analysis of 14 isolates representing each type of novel or multiple mutations and the wild type were compared with LightCycler-based PCR-gyrA hybridization mutation assay (GAMA) and single-strand conformational polymorphism (SSCP) analyses. The 14 isolates gave seven different SSCP patterns, and LightCycler detected four different mutations. DHPLC detected 11 DNA sequence variants at eight different codons, including those detected by LightCycler or SSCP. One of these mutations was silent. Five isolates contained multiple mutations, and four of these could be distinguished from the composite sequence variants by their DHPLC profile. Seven novel mutations were identified at five different loci not previously described in quinolone-resistant salmonella. DHPLC analysis proved advantageous for the detection of novel and multiple mutations. DHPLC also provides a rapid, high-throughput alternative to LightCycler and SSCP for screening frequently occurring mutations.
Resumo:
Development of an efficient tissue culture protocol in coconut is hampered by numerous technical constraints. Thus a greater understanding of the fundamental aspects of embryogenesis is essential. The role of AINTEGUMENTA-like genes in embryogenesis has been elucidated not only in model plants but also in economically important crops. A coconut gene, CnANT, that encodes two APETALA2 (AP2) domains and a conserved linker region similar to those of the BABY BOOM transcription factor was cloned, characterized, and its tissue specific expression was examined. The full-length cDNA of 1,780 bp contains a 1,425-bp open reading frame that encodes a putative peptide of 474 amino acids. The genomic DNA sequence includes 2,317 bp and consists of nine exons interrupted by eight introns. The exon/intron organization of CnANT is similar to that of homologous genes in other plant species. Analysis of differential tissue expression by real-time polymerase chain reaction indicated that CnANT is expressed more highly in in vitro grown tissues than in other vegetative tissues. Sequence comparison of the genomic sequence of CnANT in different coconut varieties revealed one single nucleotide polymorphism and one indel in the first exon and first intron, respectively, which differentiate the Tall group of trees from Dwarfs. The indel sequence, which can be considered a simple sequence repeats marker, was successfully used to distinguish the Tall and Dwarf groups as well as to develop a marker system, which may be of value in the identification of parental varieties that are used in coconut breeding programs in Sri Lanka.
Resumo:
Lunasin is a peptide from soybean seeds which has been demonstrated to have anticancer properties. It has also been reported in cereal seeds: wheat, rye, barley and Triticale. However, extensive searches of transcriptome and DNA sequence databases for wheat and other cereals have failed to identify sequences encoding either the lunasin peptide or a precursor protein. This raises the question of the origin of the lunasin reported in cereal grain.
Resumo:
The genus Cercospora contains numerous important plant pathogenic fungi from a diverse range of hosts. Most species of Cercospora are known only from their morphological characters in vivo. Although the genus contains more than 5 000 names, very few cultures and associated DNA sequence data are available. In this study, 360 Cercospora isolates, obtained from 161 host species, 49 host families and 39 countries, were used to compile a molecular phylogeny. Partial sequences were derived from the internal transcribed spacer regions and intervening 5.8S nrRNA, actin, calmodulin, histone H3 and translation elongation factor 1-alpha genes. The resulting phylogenetic clades were evaluated for application of existing species names and five novel species are introduced. Eleven species are epi-, lecto- or neotypified in this study. Although existing species names were available for several clades, it was not always possible to apply North American or European names to African or Asian strains and vice versa. Some species were found to be limited to a specific host genus, whereas others were isolated from a wide host range. No single locus was found to be the ideal DNA barcode gene for the genus, and species identification needs to be based on a combination of gene loci and morphological characters. Additional primers were developed to supplement those previously published for amplification of the loci used in this study. TAXONOMIC NOVELTIES: New species - Cercospora coniogrammes Crous & R.G. Shivas, Cercospora delaireae C. Nakash., Crous, U. Braun & H.D. Shin, Cercospora euphorbiae-sieboldianae C. Nakash., Crous, U. Braun & H.D. Shin, Cercospora pileicola C. Nakash., Crous, U. Braun & H.D. Shin, Cercospora vignigena C. Nakash., Crous, U. Braun & H.D. Shin. Typifications: epitypifications - Cercospora alchemillicola U. Braun & C.F. Hill, Cercospora althaeina Sacc., Cercospora armoraciae Sacc., Cercospora corchori Sawada, Cercospora mercurialis Pass., Cercospora olivascens Sacc., Cercospora violae Sacc.; neotypifications - Cercospora fagopyri N. Nakata & S. Takim., Cercospora sojina Hara.
Resumo:
The species limits and infraspecific DNA sequence diversity of Cyclamen libanoticum was examined. Analysis of the chloroplast DNA from six regions shows that, in C. libanoticum, only one base-pair difference is found among samples within the analysed 7066 base-pairs. This one base-pair difference (9 ‘A’s vs 10 ‘A’s) was found in the samples collected from a single site and could represent a very minor change in DNA sequence or even show the limits or accuracy of the sequencing system used. C. libanoticum is highly distinct from other congeners in DNA sequence.
Resumo:
Small changes in DNA sequence can often have major biological effects. Here the rates and yields of guanine photo-oxidation by Λ [Ru(TAP)2(dppz)]2+ have been compared in 5′-{CCGGATCCGG}2 and 5′-{CCGGTACCGG}2 using ps/ns transient visible and time-resolved IR (TRIR) spectroscopy. The inefficiency of electron transfer in the TA sequence is consistent with the 5′-TA-3′ vs. 5′-AT-3′ binding preference predicted by X-ray crystallography. The TRIR spectra also reveal the differences in binding sites in the two oligonucleotides.
Resumo:
Morphology-based delimitation of genera in the Cheilanthoid ferns has proved to be problematic and understanding of the phylogeny and relationships amongst Cheilanthoid ferns based on morphological characters has posed even further difficulties, owing perhaps in large part to adaptation by many taxa to xeric habitats, as well as convergent evolution. It is only now with the application of DNA sequence data that relationships of species and genera are becoming clear. Here, we present results of cpDNA sequence data from species that have been traditionally placed in the genus Doryopteris and, based on both these results, and morphological and distribution data, this study helps clarify the concept of the genus Doryopteris its position within the Cheilanthoid ferns and the status of Lytoneuron. As a result, three genera are redefined: Doryopteris, Lytoneuron and Ormopteris.
Resumo:
An in silico screen of 41 of the 81 coding regions of the Nicotiana plastid genome generated a shortlist of 12 candidates as DNA barcoding loci for land plants. These loci were evaluated for amplification and sequence variation against a reference set of 98 land plant taxa. The deployment of multiple primers and a modified multiplexed tandem polymerase chain reaction yielded 85–94% amplification across taxa, and mean sequence differences between sister taxa of 6.1 from 156 bases of accD to 22 from 493 bases of matK. We conclude that loci should be combined for effective diagnosis, and recommend further investigation of the following six loci: matK, rpoB, rpoC1, ndhJ, ycf5 and accD.
Resumo:
The DNA barcode potential of three regions (the nuclear ribosomal ITS and the plastid psbA-trnH and trnT-trnL intergenic spacers) was investigated for the plant genus Aspalathus L. (Fabaceac: Crotalarieae). Aspalathus is a large genus (278 species) that revealed low levels of DNA variation in phylogenetic studies. In a 51-species dataset for the psbA-trnH and ITS regions, 45%, and 16% of sequences respectively were identical to the sequence of at least one other species, with two species undiscriminated even when the two regions were combined. In contrast, trnT-trnL, discriminated between all species in this dataset. In a larger ITS and trnT-trnL dataset. including a further 82 species. 7 species in five pairwise comparisons remained Undiscriminated when the two regions were combined. Four of the five pairs of species not discriminated by sequence data were readily distinguished using a combination of qualitative and quantitative morphological data. The difficulty of barcoding in this group is increased by the presence of intraspecific variation in all three regions studied. In the case of psbA-trnH, three intraspecific samples had a sequence identical to at least one other species. Overall, psbA-trnH. currently a candidate for plant barcoding, was the least discriminatory region in our study.
Resumo:
Ancient DNA (aDNA) research has long depended on the power of PCR to amplify trace amounts of surviving genetic material from preserved specimens. While PCR permits specific loci to be targeted and amplified, in many ways it can be intrinsically unsuited to damaged and degraded aDNA templates. PCR amplification of aDNA can produce highly-skewed distributions with significant contributions from miscoding lesion damage and non-authentic sequence artefacts. As traditional PCR-based approaches have been unable to fully resolve the molecular nature of aDNA damage over many years, we have developed a novel single primer extension (SPEX)-based approach to generate more accurate sequence information. SPEX targets selected template strands at defined loci and can generate a quantifiable redundancy of coverage; providing new insights into the molecular nature of aDNA damage and fragmentation. SPEX sequence data reveals inherent limitations in both traditional and metagenomic PCR-based approaches to aDNA, which can make current damage analyses and correct genotyping of ancient specimens problematic. In contrast to previous aDNA studies, SPEX provides strong quantitative evidence that C U-type base modifications are the sole cause of authentic endogenous damage-derived miscoding lesions. This new approach could allow ancient specimens to be genotyped with unprecedented accuracy.
Resumo:
Recombination is thought to occur only rarely in animal mitochondrial DNA ( mtDNA). However, detection of mtDNA recombination requires that cells become heteroplasmic through mutation, intramolecular recombination or ' leakage' of paternal mtDNA. Interspecific hybridization increases the probability of detecting mtDNA recombinants due to higher levels of sequence divergence and potentially higher levels of paternal leakage. During a study of historical variation in Atlantic salmon ( Salmo salar) mtDNA, an individual with a recombinant haplotype containing sequence from both Atlantic salmon and brown trout ( Salmo trutta) was detected. The individual was not an F1 hybrid but it did have an unusual nuclear genotype which suggested that it was a later-generation backcross. No other similar recombinant haplotype was found from the same population or three neighbouring Atlantic salmon populations in 717 individuals collected during 1948 - 2002. Interspecific recombination may increase mtDNA variability within species and can have implications for phylogenetic studies.
Resumo:
About 5.5% of all UK hemophilia B patients have the base substitution IVS 5+13 A-->G as the only change in their factor (F)IX gene (F9). This generates a novel donor splice site which fits the consensus better than the normal intron 5 donor splice. Use of the novel splice site should result in a missense mutation followed by the abnormal addition of four amino acids to the patients' FIX. In order to explain the prevalence of this mutation, its genealogical history is examined. Analysis of restriction fragment length polymorphism in the 21 reference UK individuals (from different families) with the above mutation showed identical haplotypes in 19 while two differed from the rest and from each other. In order to investigate the history of the mutation and to verify that it had occurred independently more than once, the sequence variation in 1.5-kb segments scattered over a 13-Mb region including F9 was examined in 18 patients and 15 controls. This variation was then analyzed with a recently developed Bayesian approach that reconstructs the genealogy of the gene investigated while providing evidence of independent mutations that contribute disconnected branches to the genealogical tree. The method also provides minimum estimates of the age of the mutation inherited by the members of coherent trees. This revealed that 17 or 18 mutant genes descend from a founder who probably lived 450 years ago, while one patient carries an independent mutation. The independent recurrence of the IVS5+13 A-->G mutation strongly supports the conclusion that it is the cause of these patients' mild hemophilia.
Resumo:
The role of metal ions in determining the solution conformation of the Holliday junction is well established, but to date the picture of metal ion binding from structural studies of the four-way DNA junction is very incomplete. Here we present two refined structures of the Holliday junction formed by the sequence d(TCGGTACCGA) in the presence of Na+ and Ca2+, and separately with Sr2+ to resolutions of 1.85 Angstrom and 1.65 Angstrom, respectively. This sequence includes the ACC core found to promote spontaneous junction formation, but its structure has not previously been reported. Almost complete hydration spheres can be defined for each metal cation. The Na+ sites, the most convincing observation of such sites in junctions to date, are one on either face of the junction crossover region, and stabilise the ordered hydration inside the junction arms. The four Ca2+ sites in the same structure are at the CG/CG steps in the minor groove. The Sr2+ ions occupy the TC/AG, GG/CC, and TA/TA sites in the minor groove, giving ten positions forming two spines of ions, spiralling through the minor grooves within each arm of the stacked-X structure. The two structures were solved in the two different C2 lattices previously observed, with the Sr2+ derivative crystallising in the more highly symmetrical form with two-fold symmetry at its centre. Both structures show an opening of the minor groove face of the junction of 8.4degrees in the Ca2+ and Na+ containing structure, and 13.4degrees in the Sr2+ containing structure. The crossover angles at the junction are 39.3degrees and 43.3degrees, respectively. In addition to this, a relative shift in the base pair stack alignment of the arms of 2.3 Angstrom is observed for the Sr2+ containing structure only. Overall these results provide an insight into the so-far elusive stabilising ion structure for the DNA Holliday junction. (C) 2003 Elsevier Science Ltd. All rights reserved.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.