FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

No Association Between MTHFR A1298C and MTRR A66G Polymorphisms, and MS in an Australian Cohort

Multiple sclerosis (MS) is a complex neurological disease that affects the central nervous system (CNS) resulting in debilitating neuropathology. Pathogenesis is primarily defined by CNS inflammation and demyelination of nerve axons. Methionine synthase reductase (MTRR) is an enzyme that catalyzes the remethylation of homocysteine (Hcy) to methionine via cobalamin and folate dependant reactions. Cobalamin acts as an intermediate methyl carrier between methylenetetrahydrofolate reductase (MTHFR) and Hcy. MTRR plays a critical role in maintaining cobalamin in an active form and is consequently an important determinant of total plasma Hcy (pHcy) concentrations. Elevated intracellular pHcy levels have been suggested to play a role in CNS dysfunction, neurodegenerative, and cerebrovascular diseases. Our investigation entailed the genotyping of a cohort of 140 cases and matched controls for MTRR and MTHFR, by restriction length polymorphism (RFLP) techniques. Two polymorphisms: MTRR A66G and MTHFR A1298C were investigated in an Australian age and gender matched case-control study. No significant allelic frequency difference was observed between cases and controls at the α = 0.05 level (MTRR χ^2 = 0.005, P = 0.95, MTHFR χ^2 = 1.15, P = 0.28). Our preliminary findings suggest no association between the MTRR A66G and MTHFR A1298C polymorphisms and MS.

The origin of a Robertsonian chromosomal translocation in house mice inferred from linked microsatellite markers

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

Dependence of transient dynamics in a class-C laser upon variation of inversion with time

The transient statistics of a gain-switched coherently pumped class-C laser displays a linear correlation between the first passage time and subsequent peak intensity. Measurements are reported showing a positive or negative sign of this linear correlation, controlled through the switching time and the laser detuning. Further measurements of the small-signal laser gain combined with calculations involving a three-level laser model indicate that this sign fundamentally depends upon the way the laser inversion varies during the gain switching, despite the added dynamics of the laser polarization in the class-C laser. [S1050-2947(97)07112-6].

Anomalous resonance fluorescence and dressed-state inversion by squeezed light in a Fabry-Perot microcavity

It has been suggested that phased atomic decay in a squeezed vacuum could be detected in the fluorescence spectrum emitted from a driven two-level atom in a cavity. Recently, the existence of other very distinctive features in the fluorescence spectra arising from the nonclassical features of the squeezed vacuum has been reported. In this paper, we investigate the possibility of experimental observation of these spectra. The main obstacle to the experimentalist is ensuring an effective squeezed-vacuum-atom coupling. To overcome this problem we propose the use of a Fabry-Perot microcavity. The analysis involves a consideration of the three-dimensional nature of the electromagnetic held, and the possibility of a mismatch between the squeezed and cavity modes. The problem of squeezing bandwidths is also addressed. We show that under experimentally realistic circumstances many of the spectral anomalies predicted in free space also occur in this environment. In addition, we report large population inversions in the dressed states of the two-level atom. [S1050-2947(98)02301-4].

Gene and genotypic diversity of Phytophthora cinnamomi in South Africa and Australia revealed by DNA polymorphisms

Phytophthora cinnamomi isolates from South Africa and Australia were compared to assess genetic differentiation between the two populations. These two populations were analysed for levels of phenotypic diversity using random amplified polymorphic DNAs (RAPDs) and gene and genotypic diversity using restriction fragment length polymorphisms (RFLPs). Sixteen RAPD markers from four decanucleotide Operon primers and 34 RFLP alleles from 15 putative loci were used. A few isolates from Papua New Guinea known to posses alleles different from Australian isolates were also included for comparative purposes. South African and Australian P. cinnamomi populations were almost identical with an extremely low level of genetic distance between them (D-m = 0.003). Common features for the two populations include shared alleles, low levels of phenotypic/genotypic diversity, high clonality, and low observed and expected levels of heterozygosity. Furthermore, relatively high levels of genetic differentiation between mating type populations (D-m South Africa = 0.020 and D-m Australia = 0.025 respectively), negative fixation indices, and significant deviations from Hardy-Weinberg equilibrium, all provided evidence for the lack of frequent sexual reproduction in both populations. The data strongly suggest that both the South African and Australian P. cinnamomi populations are introduced.

Molecular cloning and chromosomal mapping of the human homologue of MYB binding protein (P160) 1A (MYBBP1A) to 17p13.3

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Extensive chromosomal variation associated with taxon divergence and host specificity in the gall-inducing scale insect Apiomorpha munita (Schrader) (Hemiptera : Sternorrhyncha : Coccoidea : Eriococcidae)

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Association of tumor necrosis factor-alpha polymorphisms and ozone-induced change in lung function

Ozone is a major air pollutant with adverse health effects which exhibit marked inter-individual variability. In mice, regions of genetic linkage with ozone-induced lung injury include the tumor necrosis factor-alpha (TNF), lymphotoxin-alpha (LTA), Toll-like receptor 4 (TLR4), superoxide dismutase (SOD2), and glutathione peroxidase (GPX1) genes. We genotyped polymorphisms in these genes in 51 individuals who had undergone ozone challenge. Mean change in FEV1 with ozone challenge, as a percentage of baseline, was -3% in TNF -308G/A or A/A individuals, compared with -9% in G/G individuals (p = 0.024). When considering TNF haplotypes, the smallest change in FEV1 with ozone exposure was associated with the TNF haplotype comprising LTA +252G/TNF -1031T/TNF -308A/TNF -238G. This association remained statistically significant after correction for age, sex, disease, and ozone concentration (p = 0.047). SOD2 or GPX1 genotypes were not associated with lung function, and the TLR4 polymorphism was too infrequent to analyze. The results of this study support TNF as a genetic factor for susceptibility to ozone-induced changes in lung function in humans, and has potential implications for stratifying health risks of air pollution.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).