The in vitro effect of different PRP concentrations on osteoblasts and fibroblasts

Objectives:The aim of this study was to assess the biological rationale for the use of platelet-rich plasma (PRP) by evaluating the effect of different concentrations of PRP on osteoblasts (OB) and fibroblasts (FB) function in vitro. Materials and methods:PRP was obtained from volunteer donors using standard protocols. Primary human cultures of oral FBs and OBs were exposed to both activated and non-activated plasma as well as various concentrations of PRP (2.5 x, 3.5 x and max (4.2-5.5 x)). Cell proliferation was evaluated after 24 and 72 h using an MTT proliferation assay. Production of osteocalcin (OCN), osteoprotegerin (OPG) and transforming growth factor beta 1 (TGF-beta 1) was evaluated in OB after 24 and 72 h. Statistical analysis was performed using one-way ANOVA. Results:PRP-stimulated cell proliferation in both OBs and FBs. The effect of different PRP concentrations on cell proliferation was most notable at 72 h. The maximum effect was achieved with a concentration of 2.5 x, with higher concentrations resulting in a reduction of cell proliferation. Upregulation of OCN levels and downregulation of OPG levels were noted with increasing PRP concentrations at both 24 and 72 h. TGF-beta 1 levels were stimulated by increasing concentrations of PRP, with the increased levels being maintained at 72 h. Conclusions:PRP preparations exert a dose-specific effect on oral FBs and OBs. Optimal results were observed at a platelet concentration of 2.5 x, which was approximately half of the maximal concentrate that could be obtained. Increased concentrations resulted in a reduction in proliferation and a suboptimal effect on OB function. Hence, different PRP concentrations may have an impact on the results that can be obtained in vivo.

Inhibition of rat platelet aggregation by the diazeniumdiolate nitric oxide donor MAHMA NONOate

1 Inhibition of rat platelet aggregation by the nitric oxide (NO) donor MAHMA NONOate (Z-1-{N-methyl-N-[6-(N-methylammoniohexyl)amino]}diazen-l-ium-1,2-diolate) was investigated. The aims were to compare its anti-aggregatory effect with vasorelaxation, to determine the effects of the soluble guanylate cyclase inhibitor, ODQ (1H-[1,2,4]oxadiazolo[4,3-ajquinoxalin-1-one), and to investigate the possible role of activation of sarco-encloplasmic reticulum calcium-ATPase (SERCA), independent of soluble guanylate cyclase, using thapsigargin. 2 MAHMA NONOate concentration-dependently inhibited sub-maximal aggregation responses to collagen (2 - 10 mug ml(-1)) and adenosine diphosphate (ADP; 2 mum) in platelet rich plasma. It was (i) more effective at inhibiting aggregation induced by collagen than by ADP, and (ii) less potent at inhibiting platelet aggregation than relaxing rat pulmonary artery. 3 ODQ (10 mum) caused only a small shift (approximately half a log unit) in the concentration-response curve to MAHMA NONOate irrespective of the aggregating agent. 4 The NO-independent activator of soluble guanylate cyclase, YC-1 (3-(5'-hydroxymethyl-2'-furyl)-1-benzy] indazole; 1 - 100 mum), did not inhibit aggregation. The cGMP analogue, 8-pCPT-cGMP (8-(4-chlorophenylthio)guanosine 3'5' cyclic monophosphate; 0.1 - 1 mm), caused minimal inhibition. 5 On collagen-aggregated platelets responses to MAHMA NONOate (ODQ 10 PM present) were abolished by thapsigargin (200 nm). On ADP-aggregated platelets thapsigargin caused partial inhibition. 6 Results with S-nitrosoglutathione (GSNO) resembled those with MAHMA NONOate. Glyceryl trinitrate and sodium nitroprusside were poor inhibitors of aggregation. 7 Thus inhibition of rat platelet aggregation by MAHMA NONOate (like GSNO) is largely ODQ-resistant and, by implication, independent of soluble guanylate cyclase. A likely mechanism of inhibition is activation of SERCA.

Rich task implementation: modernism meets postmodernism

School renewal', 'productive pedagogies', 'rich tasks', 'New Basics', 'key learning areas'--these are some of the discourses of change in selected Queensland schools. This paper will report on teaching as an insider/outsider in a school's Health and Physical Education department during a time of intense pressure for structural, curriculum and pedagogical shifts. As a teacher/researcher, I spent ten weeks in a government secondary school attempting to implement rich tasks as well as collect data using formal and informal interviews, field note, and document analyses, with a focus upon teachers', students' and administrators' sense of change processes and outcomes. It is suggested that the processes of, and barriers to, curriculum change in this context are best explained in terms of tensions between modernist and postmodernist phenomena.

Calcium is essential for the structural integrity of the cysteine-rich, ligand-binding repeat of the low-density lipoprotein receptor

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.

Inhibition of phenotype modulation, growth, and migration of vascular smooth muscle cells by a guanosine-rich 30-mer phosphorothioate oligodeoxynucleotide

The testing of a 30-mer dG-rich phosphorothioate oligodeoxynucleotide (LG4PS) for effects on the behaviour of vascular smooth muscle cells (VSMC) in vitro and in vivo is described. LG4PS at 0.3 mu M inhibited significantly the phenotype modulation of freshly isolated rabbit VSMC, and cell outgrowth from pig aortic explants was inhibited similar to 80% by 5 mu M LG4PS. The growth of proliferating rabbit and pig VSMC was inhibited similar to 70% by 0.3 mu M and 5 mu M LG4PS, respectively. Though less marked, the antiproliferative effects of LG4PS on human VSMC were comparable to those obtained with heparin. The cytotoxic effects of LG4PS on VSMC in vitro were low. Despite these promising results, adventitial application of 2-200 nmol LG4PS in pluronic gel failed to reduce vascular hyperplasia in balloon-injured rabbit carotid arteries, and the highest dose caused extensive mortality. (C) 1997 Academic Press Limited.

Focused antithrombotic therapy: Novel anti-platelet salicylates with reduced ulcerogenic potential and higher first-pass detoxification than aspirin in rats

The use of aspirin as an anti-platelet drug is limited by its propensity to induce gastric injury and by its adverse effect on vascular prostacyclin formation. Two phenolic non-steroidal anti-inflammatory drugs (salicyclic acid and diflunisal) were modified by esterification with a series of O-acyl moieties. The short-term ulcerogenic in vitro and in vivo anti-platelet properties, pharmacodynamic profiles, and extent of hepatic extraction of these phenolic esters were compared with aspirin (acetylsalicylic acid). The more lipophilic esters (longer carbon chain length in O-acyl group) show significantly less gastrotoxicity in stressed rats than does aspirin after a single oral dose. The in vitro and in vivo anti-platelet studies show that these phenolic esters inhibited (1) arachidonate-triggered human platelet aggregation and (2) thrombin-stimulated rat serum thromboxane Ag production by platelets in the clotting process almost as effectively as aspirin. The hepatic extractions of these O-acyl derivatives are significantly higher than those of aspirin. The pharmacodynamic studies show that these O-acyl derivatives of salicylic acid and diflunisal probably bind to, or combine with, the same site on the platelet cyclooxygenase as aspirin. Replacing the O-acetyl group with longer chain O-acyl moiety in this series of phenolic esters markedly reduced the potential of these agents to induce short-term gastric injury but did not lessen their activity as inhibitors of platelet aggregation. These non-acetyl salicylates may therefore represent a novel class of anti-platelet drugs with less ulcerogenic potential.

Applications of NMR in drug design: Sructure-activity relationships in disulfide-rich peptides

NMR is a powerful technique for determining structures of biologically active molecules in solution. In recent years. our laboratory has focussed on the structure determination of small disulfide-rich proteins from both plants and animals which are valuable targets in drug design applications. This article will review these structural studies and their implications in drug design.

The Las Campanas/AAT rich cluster survey - I. Precision and reliability of the photometric catalogue

The Las Campanas Observatory and Anglo-Australian Telescope Rich Cluster Survey (LARCS) is a panoramic imaging and spectroscopic survey of an X-ray luminosity-selected sample of 21 clusters of galaxies at 0.07 < z < 0.16. Charge-coupled device (CCD) imaging was obtained in B and R of typically 2 degrees wide regions centred on the 21 clusters, and the galaxy sample selected from the imaging is being used for an on-going spectroscopic survey of the clusters with the 2dF spectrograph on the Anglo-Australian Telescope. This paper presents the reduction of the imaging data and the photometric analysis used in the survey. Based on an overlapping area of 12.3 deg(2) we compare the CCD-based LARCS catalogue with the photographic-based galaxy catalogue used for the input to the 2dF Galaxy Redshift Survey (2dFGRS) from the APM, to the completeness of the GRS/APM catalogue, b(J) = 19.45. This comparison confirms the reliability of the photometry across our mosaics and between the clusters in our survey. This comparison also provides useful information concerning the properties of the GRS/APM. The stellar contamination in the GRS/APM galaxy catalogue is confirmed as around 5-10 per cent, as originally estimated. However, using the superior sensitivity and spatial resolution in the LARCS survey evidence is found for four distinct populations of galaxies that are systematically omitted from the GRS/APM catalogue. The characteristics of the 'missing' galaxy populations are described, reasons for their absence examined and the impact they will have on the conclusions drawn from the 2dF Galaxy Redshift Survey are discussed.

The Las Campanas/AAT Rich Cluster Survey - II. The environmental dependence of galaxy colours in clusters at z similar to 0.1

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).