61 resultados para TanDEM-X


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Plant performance is, at least partly, linked to the location of roots with respect to soil structure features and the micro-environment surrounding roots. Measurements of root distributions from intact samples, using optical microscopy and field tracings have been partially successful but are imprecise and labour-intensive. Theoretically, X-ray computed micro-tomography represents an ideal solution for non-invasive imaging of plant roots and soil structure. However, before it becomes fast enough and affordable or easily accessible, there is still a need for a diagnostic tool to investigate root/soil interplay. Here, a method for detection of undisturbed plant roots and their immediate physical environment is presented. X-ray absorption and phase contrast imaging are combined to produce projection images of soil sections from which root distributions and soil structure can be analyzed. The clarity of roots on the X-ray film is sufficient to allow manual tracing on an acetate sheet fixed over the film. In its current version, the method suffers limitations mainly related to (i) the degree of subjectivity associated with manual tracing and (ii) the difficulty of separating live and dead roots. The method represents a simple and relatively inexpensive way to detect and quantify roots from intact samples and has scope for further improvements. In this paper, the main steps of the method, sampling, image acquisition and image processing are documented. The potential use of the method in an agronomic perspective is illustrated using surface and sub-surface soil samples from a controlled wheat trial. Quantitative characterization of root attributes, e.g. radius, length density, branching intensity and the complex interplay between roots and soil structure, is presented and discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thirty steers were used in two pen experiments (Expts 1 and 2). and 27 of these in a third (Expt 3), to quantify their responses of hay intake, rumen ammonia nitrogen (RAN) concentrations, and liveweight to inputs of rumen soluble nitrogen (urea) and rumen undegradable protein (formaldehyde-treated casein; F-casein) when added to a basal diet of low quality hays. The hays were made From unimproved native pastures typical of those grazed by cattle in the subtropics of Australia and contained 7.8 g N/kg dry matter (DM) with coefficient of organic matter digestibility of 0.503 in Expts 1 and 2, and 5.2 g N/kg DM with a digestibility range from 0.385 to 0.448 in Expt 3. The steers (15 months old) were either Brahman (B), Hereford (H) or the F-1 Brahman x Hereford (BH) cross. Steers were offered supplementary minerals with the hays in each experiment. In Expt 1 (35 days) urea was sprayed on part of the hay, allowing for daily urea intakes (g/steer) of either 0, 5, 11, 16 or 26. In Expt 2 (42 days), F-casein was offered daily (g/steer) at either 0, 75, 150, 225 or 300 and in Expt 3 (56 days) discrete offerings were made of soluble casein (225 g/day), of urea (18 g/day) + F-casein (225 g/day) or of nil. There were significant linear effects of urea intake upon hay intake and liveweight change of steers. However, B steers had smaller increases in intake and liveweight change than did H steers, and B steers did not have a linear increase in RAN concentrations with increasing urea intake as did H and SH steers. In Expt 2 there were significant linear effects of F-casein supplements on hay intake and liveweight change of steers and a significant improvement in their feed conversion ratio (i.e. DM intake:liveweight change). The B steers did not differ from H and BH steers in liveweight change but had significantly lower hay intakes and non-significantly smaller increases in RAN with increasing F-casein intake. In Expt 3, hay intake of the steers increased with soluble casein (by 16.8 %) and with urea + F-casein (24.5 %). Only steers given urea + F-casein had a high RAN concentration (94 mg/l) and a high liveweight gain. The B steers had a liveweight loss and a lower hay intake than H or BH steers in Expt 3 but a higher RAN concentration. These studies have indicated the importance of the form and quantity of additional N required by cattle of differing breed types to optimize their feed intake and liveweight gain when offered low-N, low-digestible hays.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To facilitate the investigation of free mycophenolic acid concentrations we developed a high-performance liquid chromatography tandem mass spectrometry method using indomethacin as an internal standard. Free drug was isolated from plasma samples (500 mul) using ultrafiltration, The analytes were extracted from the ultrafiltrate (200 mul) using C-18 solid-phase extraction. Detection was by selected reactant monitoring of mycophenolic acid (m/z 318.9-->190.9) and the internal standard (m/z 356.0-->297.1) with an atmospheric pressure chemical ionisation interface. The total chromatographic analysis time was 12 min. The method was found to be linear over the range investigated, 2.5-200 mug/l (r>0.990, n=6). The relative recovery of the method for the control samples studied (7.5, 40.0 and 150 mug/l) ranged from 95 to 104%. The imprecision of the method, expressed in terms of intra- and inter-day coefficients of variation, was

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We prove that for any real number p with 1 p less than or equal to n - 1, the map x/\x\ : B-n --> Sn-1 is the unique minimizer of the p-energy functional integral(Bn) \delu\(p) dx among all maps in W-1,W-p (B-n, Sn-1) with boundary value x on phiB(n).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Axial X-ray Computed tomography (CT) scanning provides a convenient means of recording the three-dimensional form of soil structure. The technique has been used for nearly two decades, but initial development has concentrated on qualitative description of images. More recently, increasing effort has been put into quantifying the geometry and topology of macropores likely to contribute to preferential now in soils. Here we describe a novel technique for tracing connected macropores in the CT scans. After object extraction, three-dimensional mathematical morphological filters are applied to quantify the reconstructed structure. These filters consist of sequences of so-called erosions and/or dilations of a 32-face structuring element to describe object distances and volumes of influence. The tracing and quantification methodologies were tested on a set of undisturbed soil cores collected in a Swiss pre-alpine meadow, where a new earthworm species (Aporrectodea nocturna) was accidentally introduced. Given the reduced number of samples analysed in this study, the results presented only illustrate the potential of the method to reconstruct and quantify macropores. Our results suggest that the introduction of the new species induced very limited chance to the soil structured for example, no difference in total macropore length or mean diameter was observed. However. in the zone colonised by, the new species. individual macropores tended to have a longer average length. be more vertical and be further apart at some depth. Overall, the approach proved well suited to the analysis of the three-dimensional architecture of macropores. It provides a framework for the analysis of complex structures, which are less satisfactorily observed and described using 2D imaging. (C) 2002 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To describe a new syndrome of X-linked myoclonic epilepsy with generalized spasticity and intellectual disability (XMESID) and identify the gene defect underlying this disorder. Methods: The authors studied a family in which six boys over two generations had intractable seizures using a validated seizure questionnaire, clinical examination, and EEG studies. Previous records and investigations were obtained. Information on seizure disorders was obtained on 271 members of the extended family. Molecular genetic analysis included linkage studies and mutational analysis using a positional candidate gene approach. Results: All six affected boys had myoclonic seizures and TCS; two had infantile spasms, but only one had hypsarrhythmia. EEG studies show diffuse background slowing with slow generalized spike wave activity. All affected boys had moderate to profound intellectual disability. Hyperreflexia was observed in obligate carrier women. A late-onset progressive spastic ataxia in the matriarch raises the possibility of late clinical manifestations in obligate carriers. The disorder was mapped to Xp11.2-22.2 with a maximum lod score of 1.8. As recently reported, a missense mutation (1058C>T/P353L) was identified within the homeodomain of the novel human Aristaless related homeobox gene (ARX). Conclusions: XMESID is a rare X-linked recessive myoclonic epilepsy with spasticity and intellectual disability in boys. Hyperreflexia is found in carrier women. XMESID is associated with a missense mutation in ARX. This disorder is allelic with X-linked infantile spasms (ISSX; MIM 308350) where polyalanine tract expansions are the commonly observed molecular defect. Mutations of ARX are associated with a wide range of phenotypes; functional studies in the future may lend insights to the neurobiology of myoclonic seizures and infantile spasms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Clinical data from 50 mentally retarded (MR) males in nine X-linked MR families, syndromic and non-specific, with mutations (duplication, expansion, missense, and deletion mutations) in the Aristaless related homeobox gene, ARX, were analysed. Seizures were observed with all mutations and occurred in 29 patients, including one family with a novel myoclonic epilepsy syndrome associated with the missense mutation. Seventeen patients had infantile spasms. Other phenotypes included mild to moderate MR alone, or with combinations of dystonia, ataxia or autism. These data suggest that mutations in the ARX gene are important causes of MR, often associated with diverse neurological manifestations. (C) 2002 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Direct and simultaneous observation of root growth and plant water uptake is difficult because soils are opaque. X-ray imaging techniques such as projection radiography or Computer Tomography (CT) offer a partial alternative to such limitations. Nevertheless, there is a trade-off between resolution, large field-of-view and 3-dimensionality: With the current state of the technology, it is possible to have any two. In this study, we used X-ray transmission through thin-slab systems to monitor transient saturation fields that develop around roots as plants grow. Although restricted to 2-dimensions, this approach offers a large field-of-view together with high spatial and dynamic resolutions. To illustrate the potential of this technology, we grew peas in 1 cm thick containers filled with soil and imaged them at regular intervals. The dynamics of both the root growth and the water content field that developed around the roots could be conveniently monitored. Compared to other techniques such as X-ray CT, our system is relatively inexpensive and easy to implement. It can potentially be applied to study many agronomic problems, such as issues related to the impact of soil constraints (physical, chemical or biological) on root development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Exponential and sigmoidal functions have been suggested to describe the bulk density profiles of crusts. The present work aims to evaluate these conceptual models using high resolution X-radiography. Repacked seedbeds from two soil materials, air-dried or prewetted by capillary rise, were subjected to simulated rain, which resulted in three types of structural crusts, namely, slaking, infilling, and coalescing. Bulk density distributions with depth were generated using high-resolution (70 mum), calibrated X-ray images of slices from the resin-impregnated crusted seedbeds. The bulk density decreased progressively with depth, which supports the suggestion that a crust should be considered as a nonuniform layer. For the slaking and the coalescing crusts, the exponential function underestimated the strong change in bulk density across the morphologically defined transition between the crust and the underlying material; the sigmoidal function provided a better description. Neither of these crust models effectively described the shape of the bulk density profiles through the whole seedbed. Below the infilling and slaking crusts, bulk density increased linearly with depth as a result of slumping. In the coalescing crusted seedbed, the whole seedbed uniformly collapsed and most of the bulk density change within the crust could be ascribed to slumping (0.33 g cm(-3)) rather than to crusting (0.12 g cm(-3)). Finally, (i) X-radiography appears as a unique tool to generate high resolution bulk density profiles and (ii) in structural crusts, bulk density profiles could be modeled using the existing exponential and sigmoidal crusting models, provided a slumping model would be coupled.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have identified truncating mutations in the human DLG3 ( neuroendocrine dlg) gene in 4 of 329 families with moderate to severe X-linked mental retardation. DLG3 encodes synapse-associated protein 102 (SAP102), a member of the membrane-associated guanylate kinase protein family. Neuronal SAP102 is expressed during early brain development and is localized to the postsynaptic density of excitatory synapses. It is composed of three amino-terminal PDZ domains, an src homology domain, and a carboxyl-terminal guanylate kinase domain. The PDZ domains interact directly with the NR2 subunits of the NMDA glutamate receptor and with other proteins responsible for NMDA receptor localization, immobilization, and signaling. The mutations identified in this study all introduce premature stop codons within or before the third PDZ domain, and it is likely that this impairs the ability of SAP102 to interact with the NMDA receptor and/or other proteins involved in downstream NMDA receptor signaling pathways. NMDA receptors have been implicated in the induction of certain forms of synaptic plasticity, such as long-term potentiation and long-term depression, and these changes in synaptic efficacy have been proposed as neural mechanisms underlying memory and learning. The disruption of NMDA receptor targeting or signaling, as a result of the loss of SAP102, may lead to altered synaptic plasticity and may explain the intellectual impairment observed in individuals with DLG3 mutations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The use of X-ray imaging to assess variability in ceramic fabrication is common in archaeological studies aimed at examining ancient pottery technologies. In this paper, a method based on the measurement of individual pores orientation is presented. This method is successfully applied to ceramic specimens of known origin whose structure signified different deformation histories.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).