Critical sets in direct products of back circulant Latin squares

To date very Few families of critical sets for latin squares are known. The only previously known method for constructing critical sets involves taking a critical set which is known to satisfy certain strong initial conditions and using a doubling construction. This construction can be applied to the known critical sets in back circulant latin squares of even order. However, the doubling construction cannot be applied to critical sets in back circulant latin squares of odd order. In this paper a family of critical sets is identified for latin squares which are the product of the latin square of order 2 with a back circulant latin square of odd order. The proof that each element of the critical set is an essential part of the reconstruction process relies on the proof of the existence of a large number of latin interchanges.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Direct evidence for the expression of multiple endogenous retroviruses in the synovial compartment in rheumatoid arthritis

Objective. Circumstantial evidence links retroviruses (RVs) with human autoimmune diseases, The aim of the present study was to obtain direct evidence of RV gene expression in rheumatoid arthritis (RA). Methods. Synovial samples were obtained from patients with RA, patients with osteoarthritis (OA), and normal control subjects, Reverse transcription-polymerase chain reaction (RT-PCR) was performed using synovial RNA and primers to conserved sequences in the polymerase (pol) genes of known RVs. Results. PCR products (n = 857) were cloned and sequenced, Multiple pol transcripts, many with open reading frames, were expressed in every sample, Sequences were aligned and classified into 6 families (F1-F6) that contained 33 groups of known and unknown endogenous RVs (ERVs), each distinguished by a specific, deduced peptide motif, The frequency of sequences in each family was similar between RA, OA, and normal synovial tissue, but differed significantly in RA synovial fluid cells, F1 sequences (undefined, but related to murine and primate type C RVs) were lower in frequency, F2 (ERV-9-related), F4 (HERV-K-related), and F6 (HERV-L-related) sequences were higher in frequency, and F3 (RTVL-H-related) sequences were not detected, in the RA synovial fluid cells compared with the RA synovial tissues. Conclusion. Multiple ERVs are expressed in normal and diseased synovial compartments, but specific transcripts can be differentially expressed in RA.

Direct measurement of pulse distortion near the zero-dispersion wavelength in an optical fiber by frequency-resolved optical gating

The technique of frequency-resolved optical gating is used to characterize the intensity and the phase of picosecond pulses after propagation through 700 m of fiber at close to the zero-dispersion wavelength. Using the frequency-resolved optical gating technique, we directly measure the severe temporal distortion resulting from the interplay between self-phase modulation and higher-order dispersion in this regime. The measured intensity and phase of the pulses after propagation are found to be in good agreement with the predictions of numerical simulations with the nonlinear Schrodinger equation. (C) 1997 Optical Society of America.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Direct visualisation of B-1 inhomogeneity by flip angle dependency

Inhomogeneities in the spatial distribution of the excitatory Radio Frequency (RF) field, are still a dominant source of artifacts and loss of signal to noise ratio in MR imaging experiments, A number of strategies have been proposed to quantify this distribution, However, in this technical note we present a relatively simple MR imaging procedure which can be used to visualise RF inhomogeneities directly either by means of the magnitude or the phase of an image. To visualise the RF field distribution in both the inner and outer volumes of the coil, we have performed experiments in which the entire coil is submerged in a non-conducting fluid, To the best of our knowledge this strategy has not been used previously in order to evaluate coil performance, Finally, we demonstrate that the method is sensitive enough to reveal the effects of the sample properties on the effective RF wavelength of the transmitted field. (C) 1997 Elsevier Science Inc.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

On the direct product of two weak uniquely completable partial latin squares

In this note we show by counter-example that the direct product of two weak uniquely completable partial latin squares is not necessarily a uniquely completable partial latin square. This counter-example rejects a conjecture by Gower (see [3]) on the direct product of two uniquely completable partial latin squares.

The leucine-rich repeat as a protein recognition motif

Leucine-rich repeats (LRRs) are 20-29-residue sequence motifs present in a number of proteins with diverse functions. The primary function of these motifs appears to be to provide a versatile structural framework for the formation of protein-protein interactions. The past two years have seen an explosion of new structural information on proteins with LRRs. The new structures represent different LRR subfamilies and proteins with diverse functions, including GTPase-activating protein rna 1 p from the ribonuclease-inhibitor-like subfamily; spliceosomal protein U2A', Rab geranylgeranyltransferase, internalin B, dynein light chain 1 and nuclear export protein TAP from the SDS22-like subfamily; Skp2 from the cysteine-containing subfamily; and YopM from the bacterial subfamily. The new structural information has increased our understanding of the structural determinants of LRR proteins and our ability to model such proteins with unknown structures, and has shed new light on how these proteins participate in protein-protein interactions.

Targeting of EBNA1 for rapid intracellular degradation overrides the inhibitory effects of the Gly-Ala repeat domain and restores CD8+T cell recognition

Epstein-Barr virus (EBV)-encoded nuclear antigen 1 (EBNA1) includes a unique glycine-alanine repeat domain that inhibits the endogenous presentation of cytotoxic T lymphocyte (CTL) epitopes through the class I pathway by blocking proteasome-dependent degradation of this antigen. This immune evasion mechanism has been implicated in the pathogenesis of EBV-associated diseases. Here, we show that cotranslational ubiquitination combined with N-end rule targeting enhances the intracellular degradation of EBNA1, thus resulting in a dramatic reduction in the half-life of the antigen. Using DNA expression vectors encoding different forms of ubiquitinated EBNA1 for in vivo studies revealed that this rapid degradation, remarkably, leads to induction of a very strong CTL response to an EBNA1-specific CTL epitope. Furthermore, this targeting also restored the endogenous processing of HLA class I-restricted CTL epitopes within EBNA1 for immune recognition by human EBV-specific CTLs. These observations provide, for the first time, evidence that the glycine-alanine repeat-mediated proteasomal block on EBNA1 can be reversed by specifically targeting this antigen for rapid degradation resulting in enhanced CD8+ T cell-mediated recognition in vitro and in vivo.