66 resultados para C677T methylenetetrahydrofolate reductase gene mutation
Resumo:
Background: Folate metabolism is critical to embryonic development, influencing neural tube defects (NTD) and recurrent early pregnancy loss. Polymorphisms in 5,10-methylenetetrahydrofolate reductase (MTHFR) have been associated with dizygotic (DZ) twinning through pregnancy loss. Methods: The C677T and A1298C polymorphisms in MTHFR were genotyped in 258 Australasian families (1016 individuals) and 118 Dutch families (462 individuals) of mothers of DZ twins and a population sample of 462 adolescent twin families (1861 individuals). Haplotypes were constructed from the alleles, and transmission of the MTHFR haplotypes to mothers of DZ twins and from parents to twins in the adolescent twin families analysed. Results: The C677T and A1298C were common in all three populations (frequencies > 0.29). There was strong linkage disequilibrium (D'=1) between the variants, showing that specific combinations of alleles (haplotypes) were transmitted together. Three haplotypes accounted for nearly all the variation. There was no evidence of any association between MTHFR genotype and twinning in mothers of twins, or of the loss of specific MTHFR genotypes during twin pregnancies. Conclusions: It is concluded that variation in twinning frequency is not associated with MTHFR genotype.
Resumo:
A new method has been established to define the limits on a spontaneous mutation rate for a gene in Plasmodium falciparum. The method combines mathematical modelling and large-scale in vitro culturing and calculates the difference in mutant frequencies at 2 separate time-points. We measured the mutation rate at 2 positions in the dihydrofolate reductase (DHFR) gene of 3D7, a pyrimethamine-sensitive line of P. fulciparum. This line was re-cloned and an effectively large population was treated with a selective pyrimethamine concentration of 40 nM. We detected point mutations at codon-46 (TTA to TCA) and codon-108 (ACC to AAC), resulting in serine replacing leucine and asparagine replacing serine respectively in the corresponding gene product. The substitutions caused a decrease in pyrimethamine sensitivity. By mathematical modelling we determined that the mutation rate at a given position in DHFR was low and occurred at less than 2(.)5 x 10(-9) mutations/DHFR gene/replication. This result has important implications for Plasmodium genetic diversity and antimalarial drug therapy by demonstrating that even with lon mutation rates anti-malarial resistance will inevitably arise when mutant alleles are selected under drug pressure.
Resumo:
Two families, originally diagnosed as having nonsyndromic X-linked mental retardation (NSXLMR), were reviewed when it was shown that they had a 24-bp duplication (428-45 1dup(24bp)) in the ARX gene [Stromme et al., 2002: Nat Genet 30:441-445]. This same duplication had also been found in three other families: one with X-linked infantile spasms and hypsarrhythmia (X-linked West syndrome, MIM 308350) and two with XLMR and dystonic movements of the hands (Partington syndrome, MIM 309510). On review, manifestations of both West and Partington syndromes were found in some individuals from both families. In addition, it was found that one individual had autism and two had autistic behavior, one of whom had epilepsy. The degree of mental retardation ranged from mild to severe. A GCG trinucleotide expansion (GCG)10+7 and a deletion of 1,517 by in the ARX gene have also been found in association with the West syndrome, and a missense mutation (1058C >T) in a family with a newly recognized form of myoclonic epilepsy, severe mental retardation, and spastic paraplegia [Scheffer et al., 2002: Neurology, in press]. Evidently all these disorders are expressions of mutations in the same gene. It remains to be seen what proportions of patients with infantile spasms, focal dystonia, autism, epilepsy, and nonsyndromic mental retardation are accounted for by mutations in the ARX gene. (C) 2002 Wiley-Liss, Inc.
Resumo:
Background: Epidemiological studies suggest that raised plasma concentrations of total homocysteine (tHcy) may be a common, causal and treatable risk factor for atherothromboembolic ischaemic stroke. Although tHcy can be lowered effectively with small doses of folic acid, vitamin B-12 and vitamin B-6, it is not known whether lowering tHcy, by means of multivitamin therapy, can prevent stroke and other major atherothromboembolic vascular events. Purpose: To determine whether vitamin supplements (folic acid 2 mg, B-6 25 Mg, B-12 500 mug) reduce the risk of stroke, and other serious vascular events, in patients with recent stroke or transient ischaemic attacks of the brain or eye (TIA). Methods: An international, multi-centre, randomised, double-blind, placebo-controlled clinical trial. Results: As of November 2001, more than 1,400 patients have been randomised from 10 countries in four continents. Conclusion: VITATOPS aims to recruit and follow up 8,000 patients between 2000 and 2004, and provide a reliable estimate of the safety and effectiveness of dietary supplementation with folic acid, vitamin B-12, and vitamin B-6 in reducing recurrent serious vascular events among a wide range of patients with TIA and stroke. Copyright (C) 2002 S. Karger AG, Basel.
Resumo:
The epsilon4 allele of apolipoprotem E (APOE), and the plasma levels of APOE, amyloid beta-protein precursor, arnyloid beta1-40 (Abeta40) and homocysteine, (Hcy) have all been correlated with the presence of dementia. Mutations in the methylnetetrahydrofolate reductase enzyme (MTHFR) have been associated with elevated levels of Hcy. This study explored the association of these factors with cognition and depression in community dwelling older men. Two hundred and ninety-nine men, mean age 78.9 years (SD 2.8), were studied in this cross-sectional survey. Mean plasma Hcy was 13.5 (SD 5.3) mumol/L. The MTHFR genotype had no obvious impact on Hey levels. Ln Hcy and Ln Abeta40 were both inversely correlated with calculated glomerular filtration rate (cGFR), r = -0.41 (p < 0.001) and r = -0.28 (p < 0.001), respectively. There was a positive correlation between Ln Hey and Ln Abeta40, r = 0.19 (p < 0.001), which remained significant after adjusting for cGFR, with a doubling of Hcy associated with a 24% increase of Abeta40. The e4 allele was associated with increased depressive symptoms as measured by the Geriatric Depression Scale-15, Odds ratio (OR) = 2.59 (95% CI 1.06-6.34) and poorer performance on the Clock Drawing Test, OR = 2.32 (95% CI: 1.25-4.29). There was a positive association between Abeta40 and Hcy, even after adjustment for cGFR in this sample of well, community dwelling older men. This association may help elucidate the link between elevated levels of Hey and Alzheimer's disease.
Resumo:
Study objective: To investigate the effect of the voluntary folate fortification policy in Australia on serum folate and total plasma homocysteine (tHcy) concentrations. Design: Population based cohort study. Setting: Perth, Western Australia. Participants: Men and women aged 27 to 77 years (n = 468), who were originally randomly selected from the Perth electoral roll. The cohort was surveyed in 1995/96 before widespread introduction of folate fortification of a variety of foods, and followed up on two occasions, firstly in 1998/99 and again in 2001, when a moderate number of folate fortified foods were available. Subjects with abnormal serum creatinine concentrations at baseline were excluded from this analysis. Main results: Repeated measures analysis of variance was used to determine changes in serum folate and tHcy over the three surveys and to assess whether time trends were related to age, sex, MTHFR C677T genotype, or consumption of folate fortified foods. An increase (38%) in mean serum folate (p < 0.0005) and a decrease (21%) in mean tHcy (p < 0.0005) were seen after introduction of the voluntary folate fortification policy in Australia. Serum folate was consistently higher (p = 0.032) and tHcy was consistently lower (p = 0.001) in subjects who consumed at least one folate fortified food compared with subjects who did not consume any folate fortified foods in the previous week. The time related changes in serum folate and tHcy were affected only by intake of folate fortified foods (p < 0.0005) and not by any other measured variables including age, sex, or MTHFR genotype. Conclusion: Voluntary fortification of foods with folate in Australia has been followed by a substantial increase in serum folate and decrease in tHcy in the general population.
Resumo:
Multiple sclerosis (MS) is a complex neurological disease that affects the central nervous system (CNS) resulting in debilitating neuropathology. Pathogenesis is primarily defined by CNS inflammation and demyelination of nerve axons. Methionine synthase reductase (MTRR) is an enzyme that catalyzes the remethylation of homocysteine (Hcy) to methionine via cobalamin and folate dependant reactions. Cobalamin acts as an intermediate methyl carrier between methylenetetrahydrofolate reductase (MTHFR) and Hcy. MTRR plays a critical role in maintaining cobalamin in an active form and is consequently an important determinant of total plasma Hcy (pHcy) concentrations. Elevated intracellular pHcy levels have been suggested to play a role in CNS dysfunction, neurodegenerative, and cerebrovascular diseases. Our investigation entailed the genotyping of a cohort of 140 cases and matched controls for MTRR and MTHFR, by restriction length polymorphism (RFLP) techniques. Two polymorphisms: MTRR A66G and MTHFR A1298C were investigated in an Australian age and gender matched case-control study. No significant allelic frequency difference was observed between cases and controls at the α = 0.05 level (MTRR χ^2 = 0.005, P = 0.95, MTHFR χ^2 = 1.15, P = 0.28). Our preliminary findings suggest no association between the MTRR A66G and MTHFR A1298C polymorphisms and MS.
Resumo:
Although several genes for idiopathic epilepsies from families with simple Mendelian inheritance have been found, genes for the common idiopathic generalized epilepsies, where inheritance is complex, presently are elusive. We studied a large family with epilepsy where the two main phenotypes were childhood absence epilepsy (CAE) and febrile seizures (FS), which offered a special opportunity to identify epilepsy genes. A total of 35 family members had seizures over four generations. The phenotypes comprised typical CAE (eight individuals); FS alone (15), febrile seizures plus (FS+) (three); myoclonic astatic epilepsy (two); generalized epilepsy with tonic-clonic seizures alone (one); partial epilepsy (one); and unclassified epilepsy despite evaluation (two). In three remaining individuals, no information was available. FS were inherited in an autosomal dominant fashion with 75% penetrance. The inheritance of CAE in this family was not simple Mendelian, but suggestive of complex inheritance with the involvement of at least two genes. A GABA(A) receptor gamma2 subunit gene mutation on chromosome 5 segregated with FS, FS+ and CAE, and also occurred in individuals with the other phenotypes. The clinical and molecular data suggest that the GABA(A) receptor subunit mutation alone can account for the FS phenotype. An interaction of this gene with another gene or genes is required for the CAE phenotype in this family. Linkage analysis for a putative second gene contributing to the CAE phenotype suggested possible loci on chromosomes 10, 13, 14 and 15. Examination of these loci in other absence pedigrees is warranted.
Resumo:
Oropharyngeal candidiasis is a common clinical problem encountered in patients with defects in innate or cell-mediated immunity. We have previously shown that recovery from chronic oropharyngeal candidiasis is dependent on CD4+ T-cell augmentation of neutrophil and macrophage candidacidal activity, and that the immune response is characterised by the production of cytokines such as IL-12 and IFN-gamma by cells in the local draining lymph nodes, and by the expression of TNF-alpha in the oral tissues. Objective: The purpose of this study was to elaborate on the role of these cytokines in recovery from oropharyngeal candidiasis, by using cytokine-specific gene-knockout mice. Methods: These mice are created by targeted gene mutation (tm1) of embryonic stem (ES) cells microinjected into host embryos. IL-4, IL-10, IL-12, IFN-gamma and TNF-alpha knockout mice, and appropriate controls, were infected orally with 108 viable C. albicans yeasts. The infection was quantified by swabbing the oral cavity and plating on Sabouraud's agar. Results: Tnftm1mice developed an acute severe infection characterized by an increased fungal load in the early stages of infection, but cleared the yeast within the same time frame as control mice (21 days). On the other hand, Il12btm1 mice developed a chronic oropharyngeal infection (120 days) similar to that seen in T-cell deficient (Foxn1nu/Foxn1nu) mutant mice. There was no significant difference between Il4tm1, Il10tm1, and Ifngtm1 mice and their respective controls. Conclusions: Tnftm1 mice may be rendered more susceptible through impaired recruitment of phagocytic cells, and/or impaired killing of C. albicans, whereas Il12btm1 mice may not be capable of activating naïve T-cells or inducing an appropriate cellular immune response. Supported by NHMRC and ADRF.
Resumo:
Background & Aims: Nonalcoholic steatohepatitis (NASH) is a chronic liver disease that occasionally progresses to cirrhosis but usually has a benign course. The aim of this study was to investigate the role of the hemochromatosis mutation Cys282Tyr in development of the mild hepatic iron overload found in some patients with NASH and its association with hepatic damage in these patients. Methods: Fifty-one patients with NASH were studied. The presence of the Cys282Tyr mutation was tested in all patients, and the data were analyzed with respect to the histological grade of steatosis, inflammation, Perls' staining, hepatic iron concentration (HIC), and serum iron indices. Results: Thirty-one percent of patients with NASH were either homozygous or heterozygous for the Cys282Tyr mutation. This mutation was significantly associated with Perls' stain grade (P < 0.005), HIC (P < 0.005), and transferrin saturation percentage (P < 0.005) but not with serum ferritin levels. Linear regression analysis showed that increased hepatic iron (Perls' stain or HIC) had the greatest association with the severity of fibrosis (P < 0.0001). Conclusions: The Cys282Tyr mutation is responsible for most of the mild iron overload found in NASH and thus has a significant association with hepatic damage in these patients. Heterozygosity for the hemochromatosis gene mutation therefore cannot always be considered benign.
Resumo:
The majority of severe epileptic encephalopathies of early childhood are symptomatic where a clear etiology is apparent. There is a small subgroup, however, where no etiology is found on imaging and metabolic studies, and genetic factors are important. Myoclonic-astatic epilepsy (MAE) and severe myoclonic epilepsy in infancy (SMEI), also known as Dravet syndrome, are epileptic encephalopathies where multiple seizure types begin in the first few years of life associated with developmental slowing. Clinical and molecular genetic studies of the families of probands with MAE and SMEI suggest a genetic basis. MAE was originally identified as part of the genetic epilepsy syndrome generalized epilepsy with febrile seizures plus (GEFS(+)). Recent clinical genetic studies suggest that SMEI forms the most severe end of the spectrum of the GEFS(+). GEF(+) has now been associated with molecular defects in three sodium channel subunit genes and a GABA subunit gene. Molecular defects of these genes have been identified in patients with MAE and SMEI. Interestingly, the molecular defects in MAE have been found in the setting of large GEFS(+) pedigrees, whereas, more severe truncation mutations arising de novo have been identified in patients with SMEI. It is likely that future molecular studies will shed light on the interaction of a number of genes, possibly related to the same or different ion channels, which result in a severe phenotype such as MAE and SMEI. (C) 2001 Elsevier Science B.V. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
1. Improved approaches to screening and diagnosis have revealed primary aldosteronism (PAL) to be much more common than previously thought, with most patients normokalaemic. The spectrum of this disorder has been further broadened by the study of familial varieties. 2. Familial hyperaldosteronism type I (FH-I) is a glucocorticoid-remediable form of PAL caused by the inheritance of an adrenocorticotrophic hormone (ACTH)- regulated, hybrid CYP11B1/CYP11B2 gene. Diagnosis has been greatly facilitated by the advent of genetic testing. The severity of hypertension varies widely in FH-I, even among members of the same family, and has demonstrated relationships with gender, degree of biochemical disturbance and hybrid gene crossover point position. Hormone day curve studies show that the hybrid gene dominates over wild-type CYP11B2 in terms of aldosterone regulation. This may be due, in part, to a defect in wild-type CYP11B2-induced aldosterone production. Control of hypertension in FH-I requires only partial suppression of ACTH and much smaller glucocorticoid doses than previously recommended. 3. Familial hyperaldosteronism type II (FH-II) is not glucocorticoid remediable and is not associated with the hybrid gene mutation. Familial hyperaldosteronism type II is clinically, biochemically and morphologically indistinguishable from apparently non-familial PAL. Linkage studies in one informative family did not show segregation of FH-II with the CYP11B2, AT1 or MEN1 genes, but a genome-wide search has revealed linkage with a locus in chromosome 7. As has already occurred in FH-I, elucidation of causative mutations is likely to facilitate earlier detection of PAL.