100 resultados para Lambda calculus
Resumo:
Incidence calculus is a mechanism for probabilistic reasoning in which sets of possible worlds, called incidences, are associated with axioms, and probabilities are then associated with these sets. Inference rules are used to deduce bounds on the incidence of formulae which are not axioms, and bounds for the probability of such a formula can then be obtained. In practice an assignment of probabilities directly to axioms may be given, and it is then necessary to find an assignment of incidence which will reproduce these probabilities. We show that this task of assigning incidences can be viewed as a tree searching problem, and two techniques for performing this research are discussed. One of these is a new proposal involving a depth first search, while the other incorporates a random element. A Prolog implementation of these methods has been developed. The two approaches are compared for efficiency and the significance of their results are discussed. Finally we discuss a new proposal for applying techniques from linear programming to incidence calculus.
Resumo:
Dealing with uncertainty problems in intelligent systems has attracted a lot of attention in the AI community. Quite a few techniques have been proposed. Among them, the Dempster-Shafer theory of evidence (DS theory) has been widely appreciated. In DS theory, Dempster's combination rule plays a major role. However, it has been pointed out that the application domains of the rule are rather limited and the application of the theory sometimes gives unexpected results. We have previously explored the problem with Dempster's combination rule and proposed an alternative combination mechanism in generalized incidence calculus. In this paper we give a comprehensive comparison between generalized incidence calculus and the Dempster-Shafer theory of evidence. We first prove that these two theories have the same ability in representing evidence and combining DS-independent evidence. We then show that the new approach can deal with some dependent situations while Dempster's combination rule cannot. Various examples in the paper show the ways of using generalized incidence calculus in expert systems.
Resumo:
This paper discusses the relations between extended incidence calculus and assumption-based truth maintenance systems (ATMSs). We first prove that managing labels for statements (nodes) in an ATMS is equivalent to producing incidence sets of these statements in extended incidence calculus. We then demonstrate that the justification set for a node is functionally equivalent to the implication relation set for the same node in extended incidence calculus. As a consequence, extended incidence calculus can provide justifications for an ATMS, because implication relation sets are discovered by the system automatically. We also show that extended incidence calculus provides a theoretical basis for constructing a probabilistic ATMS by associating proper probability distributions on assumptions. In this way, we can not only produce labels for all nodes in the system, but also calculate the probability of any of such nodes in it. The nogood environments can also be obtained automatically. Therefore, extended incidence calculus and the ATMS are equivalent in carrying out inferences at both the symbolic level and the numerical level. This extends a result due to Laskey and Lehner.
Resumo:
We restate the notion of orthogonal calculus in terms of model categories. This provides a cleaner set of results and makes the role of O(n)-equivariance clearer. Thus we develop model structures for the category of n-polynomial and n-homogeneous functors, along with Quillen pairs relating them. We then classify n-homogeneous functors, via a zig-zag of Quillen equivalences, in terms of spectra with an O(n)-action. This improves upon the classification theorem of Weiss. As an application, we develop a variant of orthogonal calculus by replacing topological spaces with orthogonal spectra.
Resumo:
Situation calculus has been applied widely in arti?cial intelligence to model and reason about actions and changes in dynamic systems. Since actions carried out by agents will cause constant changes of the agents’ beliefs, how to manage
these changes is a very important issue. Shapiro et al. [22] is one of the studies that considered this issue. However, in this framework, the problem of noisy sensing, which often presents in real-world applications, is not considered. As a
consequence, noisy sensing actions in this framework will lead to an agent facing inconsistent situation and subsequently the agent cannot proceed further. In this paper, we investigate how noisy sensing actions can be handled in iterated
belief change within the situation calculus formalism. We extend the framework proposed in [22] with the capability of managing noisy sensings. We demonstrate that an agent can still detect the actual situation when the ratio of noisy sensing actions vs. accurate sensing actions is limited. We prove that our framework subsumes the iterated belief change strategy in [22] when all sensing actions are accurate. Furthermore, we prove that our framework can adequately handle belief introspection, mistaken beliefs, belief revision and belief update even with noisy sensing, as done in [22] with accurate sensing actions only.
Resumo:
The characterization of thermocouple sensors for temperature measurement in varying-flow environments is a challenging problem. Recently, the authors introduced novel difference-equation-based algorithms that allow in situ characterization of temperature measurement probes consisting of two-thermocouple sensors with differing time constants. In particular, a linear least squares (LS) lambda formulation of the characterization problem, which yields unbiased estimates when identified using generalized total LS, was introduced. These algorithms assume that time constants do not change during operation and are, therefore, appropriate for temperature measurement in homogenous constant-velocity liquid or gas flows. This paper develops an alternative ß-formulation of the characterization problem that has the major advantage of allowing exploitation of a priori knowledge of the ratio of the sensor time constants, thereby facilitating the implementation of computationally efficient algorithms that are less sensitive to measurement noise. A number of variants of the ß-formulation are developed, and appropriate unbiased estimators are identified. Monte Carlo simulation results are used to support the analysis.
Resumo:
The enantiomerically pure ligands LRR and LSS (N,N'-bis(-2,2'-bipyridyl-5-yl)carbonyl-(1S/R,2S/R)-(+/-)-1,2-diaminocyclohexane) have been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diaminocyclohexane respectively. The crystal structure confirmed that the ligand had a twisted orientation between the two chelating units. The reaction of LRR and LSS with Fe(II), Co(III), Cd(II) and Zn(II) afforded dinuclear complexes confirmed by ES mass spectroscopy. CD spectroscopy indicated that the chiral diaminocyclohexane conferred helicity to the metal centre giving a dominant triple helicate diastereoisomer, with the LRR ligand giving a delta-configuration of each metal centre (P helicate) and the LSS ligand a lambda configuration (M helicate). 1H NMR spectroscopy confirmed a dominant major diastereoisomer with cadmium. The Zn(II) and Cd(II) complexes however were observed to undergo rapid ligand dissociation in solution.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Abstract In the theory of central simple algebras, often we are dealing with abelian groups which arise from the kernel or co-kernel of functors which respect transfer maps (for example K-functors). Since a central simple algebra splits and the functors above are “trivial” in the split case, one can prove certain calculus on these functors. The common examples are kernel or co-kernel of the maps Ki(F)?Ki(D), where Ki are Quillen K-groups, D is a division algebra and F its center, or the homotopy fiber arising from the long exact sequence of above map, or the reduced Whitehead group SK1. In this note we introduce an abstract functor over the category of Azumaya algebras which covers all the functors mentioned above and prove the usual calculus for it. This, for example, immediately shows that K-theory of an Azumaya algebra over a local ring is “almost” the same as K-theory of the base ring. The main result is to prove that reduced K-theory of an Azumaya algebra over a Henselian ring coincides with reduced K-theory of its residue central simple algebra. The note ends with some calculation trying to determine the homotopy fibers mentioned above.
Resumo:
We present high-resolution (R = lambda/Deltalambda similar to 40 000) Ca II K interstellar observations (lambda(air) = 3933.66Angstrom) towards 88 mainly B-type stars, of which 74 are taken from the Edinburgh-Cape or Palomar-Green surveys, and 81 have > 25degrees. The majority of the data come from previously existing spectroscopy, although also included are 18 new observations of stars with echelle spectra taken with UVES on the Very Large Telescope UT2 (Kueyen). Some 49 of the sample stars have distance estimates above the Galactic plane (z) greater than or equal to 1 kpc, and are thus good probes of the halo interstellar medium. Of the 362 interstellar Ca K components that we detect, 75 (21 per cent) have absolute values of their LSR velocity values exceeding 40 km s(-1). In terms of the deviation velocity for the sightlines with distance estimates, 46/273 (17 per cent) of components have velocity values exceeding those predicted by standard Galactic rotation by more than 40 km s(-1). Combining this data set with previous observations, we find that the median value of the reduced equivalent width (REW) of stars with z greater than or equal to 1 kpc (EW x sin ) is similar to 115 mAngstrom (n = 80), similar to that observed in extragalactic sightlines by Bowen. Using data of all z distances, the REW at infinity is found to be similar to 130 mAngstrom, with the scaleheight (1) of the Ca II K column density distribution being;z 800 pc (n = 196) and reduced column density at infinity of log[N(Ca II K) cm(-2)] similar to 12.24. This implies that similar to30 per cent of Ca II K absorption occurs at distances exceeding similar to1 kpc. For nine sightlines, with distance exceeding 1 kpc and with a companion object within 5degrees, we find that all but two have values of Ca II reduced equivalent width the same to within similar to20 per cent, when the REW of the nearest object is extrapolated to the distance of the further of the pair, and assuming 1 = 800 pc. For 29 of our sightlines with z greater than or equal to 1 kpc and a H I detection from the Leiden-Dwingeloo survey (beamsize of 0.5degrees), we find log(N(Ca II K)IN(H I)) ranging from -7.4 to - 8.4. Values of the Ca II K abundance relative to neutral hydrogen (log[N(Ca II K) cm(-2)] - log[N(H I) cm(-2)]) are found to be more than similar to0.5 dex higher in stars with distances exceeding approximate to100 pc, when compared with the (log[N(Ca II K) cm(-2)] -log[N(H-tot) cm(-2)]) values found in nearby sightlines such as those in Wakker & Mathis (2000). Finally, stellar Ca II K equivalent widths of the sample are determined for 26 objects.