39 resultados para Cobalt(II) complexes


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of nitrile-functionalized ionic liquids were found to exhibit temperature-dependent miscibility (thermomorphism) with the lower alcohols. Their coordinating abilities toward cobalt(II) ions were investigated through the dissolution process of cobalt(II) bis(trifluoromethylsulfonyl)imide and were found to depend on the donor abilities of the nitrile group. The crystal structures of the cobalt(II) solvates [Co(C1C1CNPyr)2(Tf2N)4] and [Co(C1C2CNPyr)6][Tf2N]8, which were isolated from ionic-liquid solutions, gave an insight into the coordination chemistry of functionalized ionic liquids. Smooth layers of cobalt metal could be obtained by electrodeposition of the cobalt-containing ionic liquids.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Lewis acid complexes based on copper(II) and an imidazolium-tagged bis(oxazoline) have been used to catalyse the asymmetric Mukaiyama aldol reaction between methyl pyruvate and 1-methoxy-1-tri-methylsilyloxypropene under homogeneous and heterogeneous conditions. Although the ees obtained in ionic liquid were similar to those found in dichloromethane, there was a significant rate enhancement in the ionic liquid with reactions typically reaching completion within 2 min compared with only 55% conversion after 60 min in dichloromethane. However, this rate enhancement was offset by lower chemoselectivity in ionic liquids due to the formation of 3-hydroxy-1,3-diphenylbutan-1-one as a by-product. Supporting the catalyst on silica or an imidazolium-modified silica using the ionic liquid or in an ionic liquid-diethyl ether system completely suppressed the formation of this by-product without reducing the enantioselectivity. Although the heterogeneous systems were characterised by a drop in catalytic activity the system could be recycled up to five times without any loss in conversion or ee.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Colourless single crystals of [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2) were obtained from aqueous and etheric solutions of the respective components Purine, (imidazo[4,5-d]pyrimidine, Pur), 3,5-dimethyl-4 '-amino-triazole (Dat) and bis(trifluoromethyl)mercury(II), Hg(CF3)(2). [Hg(CF3)(2)(Pur)](4) crystallizes with the tetragonal system (P-4, Z = 8, a = 1486.8(2), c = 1026.2(l) pm, R-all = 0.0657) with tetrameric molecules consisting of four purine molecules bridged by slightly bent Hg(CF3)2 molecules forming a cage with the CF3 ligands surrounding this cage. The two modifications of [Hg(Dat)(CF3)2]2 (1: 170 K, triclinic, P-1, Z = 2, a 814.9(2), b = 845.4(2), c = 968.4(3) pm, alpha = 106.55(2)degrees, beta= 103.41(2)degrees, gamma = 110.79(2)degrees, R-all = 0.1189; II: monoclinic, P2(1)/c, Z = 8, a = 879.8(2), b = 1731.0(3), c = 1593.9(3) pm, beta = 106.89(2)degrees, R-all = 0.1199) both contain dimeric molecules that are stacked parallel to one crystal axis to strands which are arranged in a parallel fashion in I and rotated against each other in 11 by 110 degrees. In both, the tetrameric [Hg(CF3)(2)(Pur)](4) and the dimeric [Hg(CF3)(2)(Dat)](2) the Hg(CF3)(2) molecules are slightly bent (around 167 and 170 degrees) and rather weakly attached to the N-donor ligands Pur and Dat with Hg-N distances around 272 pm, although in both cases the Hg atoms bridge between two ligand molecules.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

There is a need to develop effective catalytic methods for alcohol oxidation. Pd(II) complexes have shown great promise as catalysts, however a comparatively small number of ligands have been reported so far. Herein we report the use of commercially available anionic N,O-ligands to produce highly active catalysts.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The disilylated compound 1,4-bis(trimethylsilyl)-2,3,5,6-tetrakis((dimethylamino)methyl)benzene, (Me(3)Si)(2)C2N4, 4, can be electrophilically palladated selectively at the C-Si bonds to afford the neutral 1,4-bis(palladium) complex [(AcOPd)(2)(C2N4)], from which the dicationic [(LPd)(2)(C2N4)](2+) (L = MeCN) organometallic species are accessible. The monosilylated species (Me(3)Si)(H)C2N4, 5, can be used for the preparation of the dicationic heterodinuclear platinum(II)-palladium(II) species [(LPd)(LPt)(C2N4)](2+) (L = MeCN) via a sequence of transmetalation of the organolithium derivative of 5 with [PtCl2(SEt(2))(2)], followed by a C-Si bond palladation reaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ligated Pd(II) complexes have been studied for the catalytic oxidation of terminal olefins to their corresponding methyl ketones. The method uses aqueous hydrogen peroxide as the terminal oxidant; a sustainable and readily accessible oxidant. The choice of ligand, counterion and solvent all have a significant effect on catalytic performance and we were able to develop systems which perform well for these challenging oxidations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Temperature-dependent switching of paramagnetism of a cobalt(ii) complex is observed in an ionic liquid solution. Paramagnetic and thermochromic switching occur simultaneously due to a reversible change in coordination. This reversible switching is possible in the ionic liquid solution, which enables mobility of thiocyanate anions by remaining mobile at low temperatures and acts as an anion reservoir.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this paper the temperature and pressure induced paramagnetic switching of cobalt (II) complex in binary mixture of phosphonium based ionic liquid [P6,6,6,14]SCN and [Co(NCS)2], is reported. This arises from a structural change in the coordination of the cobalt (II) center from tetrahedral [Co(NCS)4]2- to octahedral [Co(NCS)6]4- when mobile thiocyanate ions are added. These properties are reflected in the abrupt change of conductivity behavior of the magnetic ionic liquid. Therefore, as demonstrated herein the reversible switching in coordination of cobalt from tetrahedral to octahedral can be easily monitored at ambient as well as elevated pressure by tracking the dc-conductivity changes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of dinuclear (bipyridine)tricarbonylrhenium(I) and tris(bipyridine)ruthenium(II) complexes have been isolated and characterised, bridged by a flexible diamido ethylene glycol chain. A new stepwise synthetic pathway has been investigated to heterometallic complexes, with the rhenium(I) complexes exhibiting an unusual configuration and inequivalence of the metal centres potentially arising from a surprising hydrogen-bonding interaction between an Re–CO group and an amide proton in low-polarity solvents. This interaction appears to be broken by competing hydrogen-bonding species such as dihydrogen phosphate. This effect was not observed in the corresponding ruthenium(II) complexes, which showed very little interaction with anions. The photophysical characterisation shows that the inclusion of two ester/amide groups to the rhenium centre effectively quenches the fluorescence at room temperature. The ruthenium(II) complexes have considerably stronger fluorescence than the rhenium species, and are less affected by theinclusion of ester and amide groups to the 2,2'-bipyridine chelating group.