115 resultados para b-N-methylamino-L-alanine

em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Photoionization cross-sections out of the fine-structure levels (2S(2)2p(4) P-3(2,0,1)) of the O-like Fe ion Fe XIX have been reinvestigated. Data for photoionization out of each of these finestructure levels have been obtained, where the calculations have been performed with and without the inclusion of radiation damping on the resonance structure in order to assess the importance of this process. Recombination rate coefficients are determined using the Milne relation, for the case of an electron recombining with N-like Fe ions (Fe XX) in the ground state to form O-like Fe (Fe XIX) existing in each of the fine- structure ground-state levels. Recombination rates are presented over a temperature range similar to 4.0 less than or equal to log T-e less than or equal to 7.0, of importance to the modelling of X-ray emission plasmas.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Polyclonal antibodies were produced to detect the coccidiostat nicarbazin. Due to structural constraints of the active component of nicarbazin, dinitrocarbanilide (DNC), three different compounds that shared a common substructure with DNC were used as antigen mimics. The compounds (N-suceinyl-L-alanyl-L-alanyl-L-alanine 4-nitroanilide (SAN), L-glutamic acid gamma-(p-nitroanilide) (GAN) and p-nitrosuccinanilic acid (NSA)) were conjugated to a carrier protein and used in the immunisation of rabbits. Five different polyclonal sera were produced and consequently characterised. The antibodies exhibited an IC50 range of 2.3-7.6 ng/ml using a competitive ELISA procedure, Serum from one rabbit, R555, exhibited an IC50 of 2.9 ng/ml for DNC and cross-reactivity studies showed that this serum was specific for DNC and did not cross-react with other coccidiostats such as halofuginone, toltrazuril or ronidazole. (C) 2002 Elsevier Science B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We know now from radial velocity surveys and transit space missions thatplanets only a few times more massive than our Earth are frequent aroundsolar-type stars. Fundamental questions about their formation history,physical properties, internal structure, and atmosphere composition are,however, still to be solved. We present here the detection of a systemof four low-mass planets around the bright (V = 5.5) and close-by (6.5pc) star HD 219134. This is the first result of the Rocky Planet Searchprogramme with HARPS-N on the Telescopio Nazionale Galileo in La Palma.The inner planet orbits the star in 3.0935 ± 0.0003 days, on aquasi-circular orbit with a semi-major axis of 0.0382 ± 0.0003AU. Spitzer observations allowed us to detect the transit of the planetin front of the star making HD 219134 b the nearest known transitingplanet to date. From the amplitude of the radial velocity variation(2.25 ± 0.22 ms-1) and observed depth of the transit(359 ± 38 ppm), the planet mass and radius are estimated to be4.36 ± 0.44 M⊕ and 1.606 ± 0.086R⊕, leading to a mean density of 5.76 ± 1.09 gcm-3, suggesting a rocky composition. One additional planetwith minimum-mass of 2.78 ± 0.65 M⊕ moves on aclose-in, quasi-circular orbit with a period of 6.767 ± 0.004days. The third planet in the system has a period of 46.66 ± 0.08days and a minimum-mass of 8.94 ± 1.13 M⊕, at0.233 ± 0.002 AU from the star. Its eccentricity is 0.46 ±0.11. The period of this planet is close to the rotational period of thestar estimated from variations of activity indicators (42.3 ± 0.1days). The planetary origin of the signal is, however, thepreferredsolution as no indication of variation at the corresponding frequency isobserved for activity-sensitive parameters. Finally, a fourth additionallonger-period planet of mass of 71 M⊕ orbits the starin 1842 days, on an eccentric orbit (e = 0.34 ± 0.17) at adistance of 2.56 AU.The photometric time series and radial velocities used in this work areavailable in electronic form at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr(ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/584/A72

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We present spectral classifications for 438 B-type stars observed as part of the VLT-FLAMES Tarantula Survey (VFTS) in the 30 Doradus region of the Large Magellanic Cloud. Radial velocities are provided for 307 apparently single stars, and for 99 targets with radial-velocity variations which are consistent with them being spectroscopic binaries. We investigate the spatial distribution of the radial velocities across the 30 Dor region, and use the results to identify candidate runaway stars. Excluding potential runaways and members of two older clusters in the survey region (SL 639 and Hodge 301), we determine a systemic velocity for 30 Dor of 271.6 ± 12.2 km s-1 from 273 presumed single stars. Employing a 3σ criterion we identify nine candidate runaway stars (2.9% of the single stars with radial-velocity estimates). The projected rotational velocities of the candidate runaways appear to be significantly different to those of the full B-type sample, with a strong preference for either large (≥345 km s-1) or small (≤65 km s-1) rotational velocities. Of the candidate runaways, VFTS 358 (classified B0.5: V) has the largest differential radial velocity (-106.9 ± 16.2 km s-1), and a preliminary atmospheric analysis finds a significantly enriched nitrogen abundance of 12 + log (N/H) ≳ 8.5. Combined with a large rotational velocity (υe sin i = 345 ± 22 km s-1), this is suggestive of past binary interaction for this star.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Using a novel non-linear optical technique enantiomeric excess within a translationally disordered overlayer on a metal surface has been monitored for the first time.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Stock enhancement experiments of European lobster (Homarus gammarus) have been carried out around the Kvitsoy Islands in south-western Norway since 1990. In addition to releases of coded wire tagged lobster juveniles (cultured) and subsequent monitoring of commercial fishery, a lobster hatchery was established in 1997. Several experiments were made on the communal-rearing approach where the performance of mixed larval groups (families) was evaluated under identical conditions. Berried females of wild and cultured origin and their respective fertilised eggs were screened by using microsatellite DNA profiling involving a multiplex set of six lobster specific primers, thereby allowing determination of both parental genotypes. Each female were kept separately during hatching, and the offspring were later mixed and raised in a communal rearing system. The early-larval survival was estimated at stage IV (bottom stage), and the survivors were identified to family and group by microsatellite profiling. Five different communal experiments were conducted, representing offspring from 65 berried females. Of the surviving larvae, 6.3% could not be assigned to family due to degraded DNA and no PCR amplification. Significant differences in early survival between offspring of wild and cultured origin were found in the experiments. No differences between the groups were found in stage IV larval size. Based on the pooled data on survival (as a measure of early larvae fitness) offspring of cultured females displayed a relative fitness of 60% in comparison to offspring from wild females. Large variation in survival was also observed among families within the wild and cultured groups, suggesting a genetic component for these traits and a potential for selective breeding.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

Relevância:

100.00% 100.00%

Publicador: