22 resultados para Calf
em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.
Resumo:
Poly(vinyl alcohol)-borate complexes were evaluated as a potentially novel drug delivery platform suitable for in vivo use in photodynamic antimicrobial chemotherapy (PACT) of wound infections. An optimised formulation (8.0%w/w PVA, 2.0% w/w borax) was loaded with 1.0 mg ml(-1) of the photosensitisers Methylene Blue (MB) and meso-tetra (N-methyl-4-pyridyl) porphine tetra tosylate (TMP). Both drugs were released to yield receiver compartment concentrations (>5.0 mu g ml(-1)) found to be phototoxic to both planktonic and bicifilm-grown methicillin-resistant Staphylococcus aureus (MRSA), a common cause of wound infections in hospitals. Newborn calf serum, used to simulate the conditions prevalent in an exuding wound, did not adversely affect the properties of the hydrogels and had no significant effect on the rate of TMP-mediated photodynamic kill of MRSA, despite appreciably reducing the fluence rate of incident light. However, MB-mediated photodynamic kill of MRSA was significantly reduced in the presence of calf serum and when the clinical isolate was grown in a biofilm. Results support the contention that delivery of MB or TMP using gel-type vehicles as part of PACT could make a contribution to the photodynamic eradication of MRSA from infected wounds. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
Since 1994, Irish cattle have been exposed to greater risks of acquiring Mycobacterium avium subspecies paratuberculosis (MAP) infection as a consequence of the importation of over 70,000 animals from continental Europe. In recent years, there has been an increase in the number of reported clinical cases of paratuberculosis in Ireland. This study examines the prevalence of factors that promote the introduction and within-herd transmission of Mycobacterium avium subspecies paratuberculosis (MAP) on selected Irish dairy farms in the Cork region, and the association between these factors and the results of MAP screening tests on milk sock filter residue (MFR). A total of 59 dairy farms, selected using non-random methods but apparently free of endemic paratuberculosis, were enrolled into the study. A questionnaire was used to collect data about risk factors for MAP introduction and transmission. The MFR was assessed on six occasions over 24 months for the presence of MAP, using culture and immunomagnetic separation prior to polymerase chain reaction (IMS-PCR). Furthermore, blood samples from all entire male and female animals over one year of age in 20 herds were tested by ELISA. Eighteen (31%) farms had operated as closed herds since 1994, 28 (47%) had purchased from multiple sources and 14 (24%) had either direct or indirect (progeny) contact with imported animals. Milk and colostrum were mixed on 51% of farms, while 88% of farms fed pooled milk. Thirty (51%) herds tested negative to MFR culture and IMS-PCR, 12 (20%) were MFR culture positive, 26 (44%) were IMS-PCR positive and seven (12%) were both culture and IMS-PCR positive. The probability of a positive MFR culture was significantly associated with reduced attendance at calving, and with increased use of individual calf pens and increased (but not significantly) if multiple suckling was practised. There was poor agreement between MFR culture and MFR IMS-PCR results, but moderate agreement between MFR culture and ELISA test results. This study highlights a lack of awareness among Irish dairy farmers about the effect of inadequate biosecurity on MAP introduction. Furthermore, within-herd transmission will be facilitated by traditional calf rearing and waste management practices. The findings of viable MAP in the presence of known transmission factors in non-clinically affected herds could be a prelude to long-term problems for the Irish cattle and agri-business generally.
Resumo:
Resonance Raman (RR) spectroscopy has been used to probe the interaction between dipyridophenazine (dppz) complexes of ruthenium(II), [Ru(L)(2)(dppz)](2+) (L = 1,10-phenanthroline (1) and 2,2-bipyridyl (2)), and calf-thymus DNA. Ground electronic state RR spectra at selected probe wavelengths reveal enhancement patterns which reflect perturbation of the dppz-centered electronic transitions in the UV-vis spectra in the presence of DNA. Comparison of the RR spectra recorded of the short-lived MLCT excited states of both complexes in aqueous solution with those of the longer-lived states of the complexes in the DNA environment reveals changes to excited state modes, suggesting perturbation of electronic transitions of the dppz ligand in the excited state as a result of intercalation. The most prominent feature, at 1526 cm(-1), appears in the spectra of both 1 and 2 and is a convenient marker band for intercalation. For 1, the excited state studies have been extended to the A and A enantiomers. The marker band appears at the same frequency for both but with different relative intensities. This is interpreted as reflecting the distinctive response of the enantiomers to the chiral environment of the DNA binding sites. The results, together with some analogous data for other potentially intercalating complexes, are considered in relation to the more general application of time-resolved RR spectroscopy for investigation of intercalative interactions of photoexcited metal complexes with DNA.
Resumo:
The resonance-Raman spectroscopic technique is an effective probe of the interaction between dipyridophenazine (dppz) complexes of ruthenium(II) and calf-thymus DNA, providing evidence that DNA addition results in changes to electronic transitions of the intercalating dppz ligand in both ground and excited states.
Resumo:
Reproductive performance in the high-yielding dairy cow has severely decreased in the last 40 yr. The aim of this study was to compare the effectiveness of 4 nutritional strategies in improving the reproductive performance of high-yielding dairy cows. It was hypothesized that offering cows a high-starch ration in early lactation would enhance the onset of luteal activity, and that decreasing the severity of negative energy balance in the early postcalving period would improve reproductive parameters. Nutritional regimens aimed at improving fertility were applied to 96 Holstein-Friesian dairy animals. Upon calving, animals were allocated in a balanced manner to one of 4 dietary treatments. Primiparous animals were balanced according to live weight, body condition score and calving date. Multiparous animals were balanced according to parity, previous lactation milk yield, liveweight, body condition score and calving date. Treatment 1 was based on an industry best practice diet (control) to contain 170 g of crude protein/kg of dry matter. Treatment 2 was an individual cow feeding strategy, whereby the energy balance (EB) of individual animals was managed so as to achieve a predetermined target daily EB profile (+/- 10 MJ/d). Treatment 3 was a high-starch/high-fat combination treatment, whereby an insulinogenic (high-starch) diet was offered in early lactation to encourage cyclicity and followed by a lipogenic (low-starch, high-fat) diet to promote embryo development. Treatment 4 was a low-protein diet, containing 140 g of crude protein/kg of dry matter, supplemented with protected methionine at an inclusion level of 40 g per animal per day. The nutritional strategies implemented in this study had no statistically significant effects on cow fertility measures, which included the onset of luteal activity, conception rate, in-calf rate, and the incidence of atypical cycles. The individual cow feeding strategy improved EB in early lactation but had no benefit on conception rate to first insemination. However, conception rate to second insemination, 100-d pregnancy rate (from the commencement of breeding), and overall pregnancy rate tended to be higher in this group. The high-starch/high-fat treatment tended to decrease the proportion of delayed ovulations and increase the proportion of animals cycling by d 50 postcalving. Animals that failed to conceive to first insemination had a significantly longer luteal phase in the first cycle postpartum and a longer inter-ovulatory interval in the second cycle postpartum. With regards to estrous behavior, results indicate that as the size of the sexually active group increased, the intensity of estrus and the expression of mounting or attempting to mount another cow also increased. Furthermore, cows that became pregnant displayed more intense estrous behavior than cows that failed to become pregnant.
Resumo:
Eighteen participants (22-43 years) were randomly allocated to one of two groups: resistance training combined with vibration (VIB; five males, four females) or resistance training alone (CON; five males, four females). Each participant trained three sessions per week (three sets of 10 seated calf raises against a load, which was increased progressively from 75% of one repetition maximum (1RM) to 90% 1RM for 4 weeks. For the VIB group, a vibratory stimulus (30 Hz, 2.5 mm amplitude) was applied to the soles of the feet by a vibration platform. The two groups did not differ significantly with respect to the total amount of work performed during training. Both groups showed a significant increase in maximum voluntary contraction and 1RM (P
Resumo:
Molecularly imprinted polymers (MIPs) selective for scopolamine were produced using hyoscyamine (a close structural analogue) as template molecule. The produced polymers were used as media for solid-phase extraction, exhibiting selective binding properties for the analyte from biological samples. Human and calf urine and serum were processed on the MIP under various extraction protocols. The best performance was observed after loading the analyte in aqueous environment facilitating retention on the MIP by non-selective hydrophobic interactions. The MIPs were subsequently washed using an optimised solvent system to enable selective desorption of the analyte. Other related and non-related compounds were accessed to evaluate molecular recognition properties. Recoveries of up to 79% were achieved for the analyte of interest from biological samples.
Resumo:
PURPOSE. This study evaluated the effect of transforming growth factor (TGF)-ß2 and anti-TGF-ß2 antibody in a rodent model of posterior capsule opacification (PCO). METHODS. An extracapsular lens extraction (ECLE) was performed in 72 Sprague-Dawley rats. At the end of the procedure, 10 µL TGF-ß2 (TGF-ß2-treated group), fetal calf serum (FCS)/phosphate- buffered saline (PBS; FCS/PBS-treated control group), a human monoclonal TGF-ß2 antibody (anti-TGF-ß2-treated group), or a null control IgG4 antibody (null antibody-treated control group) was injected into the capsule. Animals were killed 3 and 14 days postoperatively. Eyes were evaluated clinically prior to euthanatization, then enucleated and processed for light microscopy and immunohistochemistry afterward. PCO was evaluated clinically and histopathologically. Student's t-test and ? were used to assess differences between groups. RESULTS. There were no statistically significant clinical or histopathological differences in degree of PCO between the TGF-ß2- and FCS/PBS-treated groups at 3 and 14 days after ECLE. Nor were there differences between the anti-TGF-ß2- and the null antibody-treated groups, with the exception of the histopathology score for capsule wrinkling 3 days after ECLE (P = 0.02). a-Smooth-muscle actin staining was observed in the lens capsular bag only in areas where there was close contact with the iris. CONCLUSIONS. No sustained effect of TGF-ß2 or anti-TGF-ß2 antibody on PCO was found in rodents at the dose and timing administered in this study. Iris cells may play a role in the process of epithelial mesenchymal transition linked to PCO. Copyright © Association for Research in Vision and Ophthalmology.
Resumo:
The effect of the highly vasoactive peptide endothelin 1 (ET1) was tested on bovine retinal microvascular pericytes propagated in vitro. Specific binding of 125I-ET1 to retinal pericytes was documented by autoradiography. ET1 caused contraction of pericytes at a concentration of 0.1 nM which was accompanied by increases in inositol phosphates. Exposure of pericytes to 10 nM ET1 resulted in the aggregation and realignment of muscle-specific actins into bundles which were oriented parallel to the long axis of the cell, and ET1 was also mitogenic to pericytes in the presence of low levels of fetal calf serum. These observations suggest that ET1 may play an important role in endothelial cell-pericyte interactions within the microvasculature of the retina and that it may be involved in the autoregulation of retinal blood flow.
Resumo:
Purpose. To develop a protocol for isolating and culturing murine adult retinal microglia and to characterize the phenotype and function of the cultured cells. Method. Retinal single-cell suspensions were prepared from adult MF1 mice. Culture conditions including culture medium, growth factors, seeding cell density, and purification of microglia from the mixed cultures were optimised. Cultured retinal microglial cells were phenotyped using the surface markers CD45, CD11b, and F4/80. Their ability to secrete proinflammatory cytokines in response to lipopolysaccharide (LPS) stimulation was examined using cytometric bead array (CBA) assay. Results. Higher yield was obtained when retinal single-cell suspension was cultured at the density of cells per cm2 in Dulbecco’s modified Eagle medium (DMEM)/F12 + Glutamax supplement with 20% fetal calf serum (FCS) and 20% L929 supernatant. We identified day 10 to be the optimum day of microglial isolation. Over 98% of the cells isolated were positive for CD45, CD11b, and F4/80. After stimulating with LPS they were able to secrete proinflammatory cytokines such as IL-6 and TNF-α and express CD86, CD40, and MHC-II. Conclusion. We have developed a simple method for isolating and culturing retinal microglia from adult mice.
Resumo:
The current study focuses on the effect of the material type and the lubricant on the abrasive wear behaviour of two important commercially available ceramic on ceramic prosthetic systems, namely, Biolox(R) forte and Bioloxl(R) delta (CeramTec AG, Germany). A standard microabrasion wear apparatus was used to produce '3-body' abrasive wear scars with three different lubricants: ultrapure water, 25 vol% new-born calf serum solution and 1 wt% carboxymethyl cellulose sodium salt (CMC-Na) solution. 1 mu m alumina particles were used as the abrasive. The morphology of the wear scar was examined in detail using Atomic Force Microscopy (AFM) and Scanning Electron Microscopy (SEM). Subsurface damage accumulation was investigated by Focused Ion Beam (FIB) cross-sectional milling and Transmission Electron Microscopy (TEM). The effect of the lubricant on the '3-body' abrasive wear mechanisms is discussed and the effect of material properties compared. (C) 2009 Elsevier B.V. All rights reserved.