The Calreticulin gene and myeloproliferative neoplasms

The Philadelphia negative myeloproliferative neoplasms include polycythaemia vera (PV), essential thrombocytopenia (ET) and primary myelofibrosis (PMF). Patients with these conditions were mainly thought to harbour JAK2V617F mutations or an Myeloproliferative leukaemia (MPL) substitution. In 2013, two revolutionary studies identified recurrent mutations in a gene that encodes the protein calreticulin (CALR). This mutation was detected in patients with PMF and ET with non-mutated JAK2 or MPL but was absent in patients with PV. The CALR gene encodes the calreticulin protein, which is a multifactorial protein, mainly located in the endoplasmic reticulum in chromosome 19 and regulates calcium homeostasis, chaperones and has also been implicated in multiple cellular processes including cell signalling, regulation of gene expression, cell adhesion, autoimmunity and apoptosis. Somatic 52 bp deletions and recurrent 52 bp insertion mutations in CALR were detected and all resulted in frameshift and clusters in exon 9 of the gene. This review will summarise the current knowledge on the CALR gene and mutation of the gene in pathological conditions and patient phenotypes.

Expression of vascular endothelial growth factor (VEGF) and its receptors is regulated in eyes with intra-ocular tumours

The immunolocalization and gene expression of vascular endothelial growth factor (VEGF) and its cognate tyrosine kinase receptors, Flt-1 and KDR, has been studied in ocular melanomas and retinoblastomas using in situ hybridization and immunohistochemistry. Tumour-related alterations in VEGF/VEGF-receptor expression have also been examined in separate and uninvolved iris, retina and choroid of the same eyes. Although VEGF immunoreactivity in the normal retina was virtually absent, low-level VEGF expression was evident in the ganglion cell-bodies, Müller cells and in a distinct population of amacrine cells. VEGF gene expression was absent in the iris and choroid of normal eyes. In tumour-bearing eyes, high levels of VEGF protein and gene expression were observed within the vascularized regions of the tumours, while the adjacent retina and choroid showed increased VEGF levels when compared with normals. Flt-1 and KDR gene expression and immunolocalization occurred in VEGF-expressing ganglion, Müller and amacrine cells in normal eyes. Within the intra-ocular tumours, VEGF-receptor gene expression and protein was evident in the endothelial cells and also in cells close to the vessels, while in the adjacent retina, Flt-1 and KDR levels were elevated over normal, especially in the blood vessels. Flt-1 and KDR were both observed at elevated levels in the choroid and iris blood vessels. This study suggests that VEGF, Flt-1 and KDR are expressed by neural, glial and vascular elements within normal human retina. Intra-ocular tumours demonstrate a high level of VEGF and VEGF-receptor expression; within uninvolved, spatially separate retina, choroid and iris in the same eyes, expression is also elevated, especially within the vasculature. Retinal vascular endothelia may respond to high intra-ocular levels of VEGF by increasing expression of their VEGF receptors, a phenomenon which could have relevance to neoplasm-related ocular neovascularization.

Characterization of a thymidylate synthase (TS)-inducible cell line: a model system for studying sensitivity to TS- and non-TS-targeted chemotherapies

Thymidylate synthase (TS) is responsible for the de novo synthesis of thymidylate, which is required for DNA synthesis and repair and which is an important target for fluoropyrimidines such as 5-fluorouracil (5-FU), and antifolates such as Tomudex (TDX), ZD9331, and multitargeted antifolate (MTA). To study the importance of TS expression in determining resistance to these agents, we have developed an MDA435 breast cancer-derived cell line with tetracycline-regulated expression of TS termed MTS-5. We have demonstrated that inducible expression of TS increased the IC(50) dose of the TS-targeted therapeutic agents 5-FU, TDX, and ZD9331 by 2-, 9- and 24-fold respectively. An IC(50) dose for MTA was unobtainable when TS was overexpressed in these cells, which indicated that MTA toxicity is highly sensitive to increased TS expression levels. The growth inhibitory effects of the chemotherapeutic agents CPT-11, cisplatin, oxaliplatin, and Taxol were unaffected by TS up-regulation. Cell cycle analyses revealed that IC(50) doses of 5-FU, TDX and MTA caused an S-phase arrest in cells that did not overexpress TS, and this arrest was overcome when TS was up-regulated. Furthermore, the S-phase arrest was accompanied by 2- to 4-fold increased expression of the cell cycle regulatory genes cyclin E, cyclin A, and cyclin dependent kinase 2 (cdk2). These results indicate that acute increases in TS expression levels play a key role in determining cellular sensitivity to TS-directed chemotherapeutic drugs by modulating the degree of S-phase arrest caused by these agents. Moreover, CPT-11, cisplatin, oxaliplatin, and Taxol remain highly cytotoxic in cells that overexpress TS.

The Role of Thymidylate Synthase Induction in Modulating p53-regulated Gene Expression in Response to 5-Fluorouracil and Antifolates

Thymidylate synthase (TS) is a critical target for chemotherapeutic agents such as 5-fluorouracil (5-FU) and antifolates such as tomudex (TDX),multitargeted antifolate, and ZD9331. Using the MCF-7 breast cancer line, we have developed p53 wild-type (M7TS90) and null (M7TS90-E6) isogenic lines with inducible TS expression (approximately 6-fold induction compared with control after 48 h). In the M7TS90 line, inducible TS expression resulted in a moderate approximately 3-fold increase in 5-FU IC-50(72 h) dose and a dramatic >20-fold increase in the IC-50(72 h) doses of TDX, multitargeted antifolate, and ZD9331. S-phase cell cycle arrest and apoptosis induced by the antifolates were abrogated by TS induction. In contrast, cell cycle arrest and apoptosis induced by 5-FU was unaffected by TS expression levels. Inactivation of p53 significantly increased resistance to 5-FU and the antifolates with IC-50(72 h) doses for 5-FU and TDX of >100 and >10 microM, respectively, in the M7TS90-E6 cell line. Furthermore, p53 inactivation completely abrogated the cell cycle arrest and apoptosis induced by 5-FU. The antifolates induced S-phase arrest in the p53 null cell line; however, the induction of apoptosis by these agents was significantly reduced compared with p53 wild-type cells. Both inducible TS expression and the addition of exogenous thymidine (10 microM) blocked p53 and p21 induction by the antifolates but not by 5-FU in the M7TS90 cell line. Similarly, inducible TS expression and exogenous thymidine abrogated antifolate but not 5-FU-mediated up-regulation of Fas/CD95 in M7TS90 cells. Our results indicate that in M7TS90 cells, inducible TS expression modulates p53 and p53 target gene expression in response to TS-targeted antifolate therapies but not to 5-FU.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Cytohesin Binder and Regulator (Cybr) is Not Essential for T- and Dendritic-Cell Activation and Differentiation

Cybr (also known as Cytip, CASP, and PSCDBP) is an interleukin-12-induced gene expressed exclusively in hematopoietic cells and tissues that associates with Arf guanine nucleotide exchange factors known as cytohesins. Cybr levels are dynamically regulated during T-cell development in the thymus and upon activation of peripheral T cells. In addition, Cybr is induced in activated dendritic cells and has been reported to regulate dendritic cell (DC)-T-cell adhesion. Here we report the generation and characterization of Cybr-deficient mice. Despite the selective expression in hematopoietic cells, there was no intrinsic defect in T- or B-cell development or function in Cybr-deficient mice. The adoptive transfer of Cybr-deficient DCs showed that they migrated efficiently and stimulated proliferation and cytokine production by T cells in vivo. However, competitive stem cell repopulation experiments showed a defect in the abilities of Cybr-deficient T cells to develop in the presence of wild-type precursors. These data suggest that Cybr is not absolutely required for hematopoietic cell development or function, but stem cells lacking Cybr are at a developmental disadvantage compared to wild-type cells. Collectively, these data demonstrate that despite its selective expression in hematopoietic cells, the role of Cybr is limited or largely redundant. Previous in vitro studies using overexpression or short interfering RNA inhibition of the levels of Cybr protein appear to have overestimated its immunological role.

Malignancy and mortality in a population-based cohort of patients with coeliac disease or 'gluten sensitivity'

Aim: To determine the risk of malignancy and mortality in patients with a positive endomysial or anti-gliadin antibody test in Northern Ireland.

Methods: A population-based retrospective cohort study design was used. Laboratory test results used in the diagnosis of coeliac disease were obtained from the Regional Immunology Laboratory, cancer statistics from the Northern Ireland Cancer Registry and mortality statistics from the General Registrar Office, Northern Ireland. Age standardized incidence ratios of malignant neoplasms and standardized mortality ratios of all-cause and cause-specific mortality were calculated.

Results: A total of 13 338 people had an endomysial antibody and/or an anti-gliadin antibody test in Northern Ireland between 1993 and 1996. There were 490 patients who tested positive for endomysial antibodies and they were assumed to have coeliac disease. There were 1133 patients who tested positive for anti-gliadin anti-bodies and they were defined as gluten sensitive. Malignant neoplasms were not significantly associated with coeliac disease; however, all-cause mortality was significantly increased following diagnosis. The standardized incidence and mortality ratios for non-Hodgkin's lymphoma were increased in coeliac disease patients but did not reach statistical significance. Lung and breast cancer incidence were significantly lower and all-cause mortality, mortality from malignant neoplasms, non-Hodgkin's lymphoma and digestive system disorders were significantly higher in gluten sensitive patients compared to the Northern Ireland population.

Conclusion: Patients with coeliac disease or gluten sensitivity had higher mortality rates than the Northern Ireland population. This association persists more than one year after diagnosis in patients testing positive for anti-gliadin antibodies. Breast cancer is significantly reduced in the cohort of patients with gluten sensitivity. © 2007 The WJG Press. All rights reserved.

Significantly improved PCR-based clonality testing in B-cell malignancies by use of multiple immunoglobulin gene targets: Report of the BIOMED-2 Concerted Action BHM4-CT98-3936.

Polymerase chain reaction (PCR) assessment of clonal immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements is an important diagnostic tool in mature B-cell neoplasms. However, lack of standardized PCR protocols resulting in a high level of false negativity has hampered comparability of data in previous clonality studies. In order to address these problems, 22 European laboratories investigated the Ig/TCR rearrangement patterns as well as t(14;18) and t(11;14) translocations of 369 B-cell malignancies belonging to five WHO-defined entities using the standardized BIOMED-2 multiplex PCR tubes accompanied by international pathology panel review. B-cell clonality was detected by combined use of the IGH and IGK multiplex PCR assays in all 260 definitive cases of B-cell chronic lymphocytic leukemia (n¼56), mantle cell lymphoma (n¼54), marginal zone lymphoma (n¼41) and follicular lymphoma (n¼109). Two of 109 cases of diffuse large B-cell lymphoma showed no detectable clonal marker. The use of these techniques to assign cell lineage should be treated with caution as additional clonal TCR gene rearrangements were frequently detected in all disease categories. Our study indicates that the BIOMED-2 multiplex PCR assays provide a powerful strategy for clonality assessment in B-cell malignancies resulting in high Ig clonality detection rates particularly when IGH and IGK strategies are combined.

Molecular basis for estrogen receptor alpha deficiency in BRCA1-linked breast cancer

Background BRCA1-mutant breast tumors are typically estrogen receptor alpha (ER alpha) negative, whereas most sporadic tumors express wild-type BRCA1 and are ER alpha positive. We examined a possible mechanism for the observed ER alpha-negative phenotype of BRCA1-mutant tumors.

Methods We used a breast cancer disease-specific microarray to identify transcripts that were differentially expressed between paraffin-embedded samples of 17 BRCA1-mutant and 14 sporadic breast tumors. We measured the mRNA levels of estrogen receptor 1 (ESR1) ( the gene encoding ER alpha), which was differentially expressed in the tumor samples, by quantitative polymerase chain reaction. Regulation of ESR1 mRNA and ER alpha protein expression was assessed in human breast cancer HCC1937 cells that were stably reconstituted with wild-type BRCA1 expression construct and in human breast cancer T47D and MCF-7 cells transiently transfected with BRCA1-specific short-interfering RNA ( siRNA). Chromatin immunoprecipitation assays were performed to determine if BRCA1 binds the ESR1 promoter and to identify other interacting proteins. Sensitivity to the antiestrogen drug fulvestrant was examined in T47D and MCF-7 cells transfected with BRCA1-specific siRNA. All statistical tests were two-sided.

Results Mean ESR1 gene expression was 5.4-fold lower in BRCA1-mutant tumors than in sporadic tumors ( 95% confidence interval [CI]=2.6-fold to 40.1-fold, P =.0019). The transcription factor Oct-1 recruited BRCA1 to the ESR1 promoter, and both BRCA1 and Oct-1 were required for ER alpha expression. BRCA1-depleted breast cancer cells expressing exogenous ER alpha were more sensitive to fulvestrant than BRCA1-depleted cells transfected with empty vector ( T47D cells, the mean concentration of fulvestrant that inhibited the growth of 40% of the cells [IC40] for empty vector versus ER alpha: > 10(-5) versus 8.0 x 10(-9) M [ 95% CI=3.1x10(-10) to 3.2 x 10(-6) M]; MCF-7 cells, mean IC40 for empty vector versus ER alpha : > 10(-5) versus 4.9 x 10(-8) M [ 95% CI=2.0 x 10(-9) to 3.9 x 10(-6) M]).

Conclusions BRCA1 alters the response of breast cancer cells to antiestrogen therapy by directly modulating ER alpha expression.

ZAP-70 restoration in mice by in vivo thymic electroporation.

Viral and non-viral vectors have been developed for gene therapy, but their use is associated with unresolved problems of efficacy and safety. Efficient and safe methods of DNA delivery need to be found for medical application. Here we report a new monopolar system of non-viral electro-gene transfer into the thymus in vivo that consists of the local application of electrical pulses after the introduction of the DNA. We assessed the proof of concept of this approach by correcting ZAP-70 deficient severe combined immunodeficiency (SCID) in mice. The thymic electro-gene transfer of the pCMV-ZAP-70-IRES-EGFP vector in these mice resulted in rapid T cell differentiation in the thymus with mature lymphocytes detected by three weeks in secondary lymphoid organs. Moreover, this system resulted in the generation of long-term functional T lymphocytes. Peripheral reconstituted T cells displayed a diversified T cell receptor (TCR) repertoire, and were responsive to alloantigens in vivo. This process applied to the thymus could represent a simplified and effective alternative for gene therapy of T cell immunodeficiencies.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

The pathophysiology of HOX genes and their role in cancer

The HOM-C clustered prototype homeobox genes of Drosophila, and their counterparts, the HOX genes in humans, are highly conserved at the genomic level. These master regulators of development continue to be expressed throughout adulthood in various tissues and organs. The physiological and patho-physiological functions of this network of genes are being avidly pursued within the scientific community, but defined roles for them remain elusive. The order of expression of HOX genes within a cluster is co-ordinated during development, so that the 3' genes are expressed more anteriorly and earlier than the 5' genes. Mutations in HOXA13 and HOXD13 are associated with disorders of limb formation such as hand-foot-genital syndrome (HFGS), synpolydactyly (SPD), and brachydactyly. Haematopoietic progenitors express HOX genes in a pattern characteristic of the lineage and stage of differentiation of the cells. In leukaemia, dysregulated HOX gene expression can occur due to chromosomal translocations involving upstream regulators such as the MLL gene, or the fusion of a HOX gene to another gene such as the nucleoporin, NUP98. Recent investigations of HOX gene expression in leukaemia are providing important insights into disease classification and prediction of clinical outcome. Whereas the oncogenic potential of certain HOX genes in leukaemia has already been defined, their role in other neoplasms is currently being studied. Progress has been hampered by the experimental approach used in many studies in which the expression of small subsets of HOX genes was analysed, and complicated by the functional redundancy implicit in the HOX gene system. Attempts to elucidate the function of HOX genes in malignant transformation will be enhanced by a better understanding of their upstream regulators and downstream target genes.

IL-12R2 promotes the development of CD4+CD25+ regulatory T cells

We have previously shown that mice lacking the IL-12-specific receptor subunit ß2 (IL-12Rß2) develop more severe experimental autoimmune encephalomyelitis than wild-type (WT) mice. The mechanism underlying this phenomenon is not known; nor is it known whether deficiency of IL-12Rß2 impacts other autoimmune disorders similarly. In the present study we demonstrate that IL-12Rß2-/- mice develop earlier onset and more severe disease in the streptozotocin-induced model of diabetes, indicating predisposition of IL-12Rß2-deficient mice to autoimmune diseases. T cells from IL-12Rß2-/- mice exhibited significantly higher proliferative responses upon TCR stimulation. The numbers of naturally occurring CD25+CD4+ regulatory T cells (Tregs) in the thymus and spleen of IL-12Rß2-/- mice were comparable to those of WT mice. However, IL-12Rß2-/- mice exhibited a significantly reduced capacity to develop Tregs upon stimulation with TGF-ß, as shown by significantly lower numbers of CD25+CD4+ T cells that expressed Foxp3. Functionally, CD25+CD4+ Tregs derived from IL-12Rß2-/- mice were less efficient than those from WT mice in suppressing effector T cells. The role of IL-12Rß2 in the induction of Tregs was confirmed using small interfering RNA. These findings suggest that signaling via IL-12Rß2 regulates both the number and functional maturity of Treg cells, which indicates a novel mechanism underlying the regulation of autoimmune diseases by the IL-12 pathway. Copyright © 2008 by The American Association of Immunologists, Inc.