89 resultados para RU(BPY)(3)(3 )-BASED CHEMILUMINESCENCE DETECTION


Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this paper, we have developed a low-complexity algorithm for epileptic seizure detection with a high degree of accuracy. The algorithm has been designed to be feasibly implementable as battery-powered low-power implantable epileptic seizure detection system or epilepsy prosthesis. This is achieved by utilizing design optimization techniques at different levels of abstraction. Particularly, user-specific critical parameters are identified at the algorithmic level and are explicitly used along with multiplier-less implementations at the architecture level. The system has been tested on neural data obtained from in-vivo animal recordings and has been implemented in 90nm bulk-Si technology. The results show up to 90 % savings in power as compared to prevalent wavelet based seizure detection technique while achieving 97% average detection rate. Copyright 2010 ACM.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Freshwater and brackish microalgal toxins, such as microcystins, cylindrospermopsins, paralytic toxins, anatoxins or other neurotoxins are produced during the overgrowth of certain phytoplankton and benthic cyanobacteria, which includes either prokaryotic or eukaryotic microalgae. Although, further studies are necessary to define the biological role of these toxins, at least some of them are known to be poisonous to humans and wildlife due to their occurrence in these aquatic systems. The World Health Organization (WHO) has established as provisional recommended limit 1 μg of microcystin-LR per liter of drinking water. In this work we present a microsphere-based multi-detection method for five classes of freshwater and brackish toxins: microcystin-LR (MC-LR), cylindrospermopsin (CYN), anatoxin-a (ANA-a), saxitoxin (STX) and domoic acid (DA). Five inhibition assays were developed using different binding proteins and microsphere classes coupled to a flow-cytometry Luminex system. Then, assays were combined in one method for the simultaneous detection of the toxins. The IC50's using this method were 1.9 ± 0.1 μg L−1 MC-LR, 1.3 ± 0.1 μg L−1 CYN, 61 ± 4 μg L−1 ANA-a, 5.4 ± 0.4 μg L−1 STX and 4.9 ± 0.9 μg L−1 DA. Lyophilized cyanobacterial culture samples were extracted using a simple procedure and analyzed by the Luminex method and by UPLC–IT-TOF-MS. Similar quantification was obtained by both methods for all toxins except for ANA-a, whereby the estimated content was lower when using UPLC–IT-TOF-MS. Therefore, this newly developed multiplexed detection method provides a rapid, simple, semi-quantitative screening tool for the simultaneous detection of five environmentally important freshwater and brackish toxins, in buffer and cyanobacterial extracts.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

New Findings

What is the central question of this study?Exercise performance is limited during hypoxia by a critical reduction in cerebral and skeletal tissue oxygenation. To what extent an elevation in systemic free radical accumulation contributes to microvascular deoxygenation and the corresponding reduction in maximal aerobic capacity remains unknown.What is the main finding and its importance?We show that altered free radical metabolism is not a limiting factor for exercise performance in hypoxia, providing important insight into the fundamental mechanisms involved in the control of vascular oxygen transport.

Exercise performance in hypoxia may be limited by a critical reduction in cerebral and skeletal tissue oxygenation, although the underlying mechanisms remain unclear. We examined whether increased systemic free radical accumulation during hypoxia would be associated with elevated microvascular deoxygenation and reduced maximal aerobic capacity (). Eleven healthy men were randomly assigned single-blind to an incremental semi-recumbent cycling test to determine  in both normoxia (21% O2) and hypoxia (12% O2) separated by a week. Continuous-wave near-infrared spectroscopy was employed to monitor concentration changes in oxy- and deoxyhaemoglobin in the left vastus lateralis muscle and frontal cerebral cortex. Antecubital venous blood samples were obtained at rest and at  to determine oxidative (ascorbate radical by electron paramagnetic resonance spectroscopy), nitrosative (nitric oxide metabolites by ozone-based chemiluminescence and 3-nitrotyrosine by enzyme-linked immunosorbent assay) and inflammatory stress biomarkers (soluble intercellular/vascular cell adhesion 1 molecules by enzyme-linked immunosorbent assay). Hypoxia was associated with increased cerebral and muscle tissue deoxygenation and lower  (P < 0.05 versus normoxia). Despite an exercise-induced increase in oxidative–nitrosative–inflammatory stress, hypoxia per se did not have an additive effect (P > 0.05 versus normoxia). Consequently, we failed to observe correlations between any metabolic, haemodynamic and cardiorespiratory parameters (P > 0.05). Collectively, these findings suggest that altered free radical metabolism cannot explain the elevated microvascular deoxygenation and corresponding lower  in hypoxia. Further research is required to determine whether free radicals when present in excess do indeed contribute to the premature termination of exercise in hypoxia.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The increasing scale of Multiple-Input Multiple- Output (MIMO) topologies employed in forthcoming wireless communications standards presents a substantial implementation challenge to designers of embedded baseband signal processing architectures for MIMO transceivers. Specifically the increased scale of such systems has a substantial impact on the perfor- mance/cost balance of detection algorithms for these systems. Whilst in small-scale systems Sphere Decoding (SD) algorithms offer the best quasi-ML performance/cost balance, in larger systems heuristic detectors, such Tabu-Search (TS) detectors are superior. This paper addresses a dearth of research in architectures for TS-based MIMO detection, presenting the first known realisations of TS detectors for 4 × 4 and 10 × 10 MIMO systems. To the best of the authors’ knowledge, these are the largest single-chip detectors on record.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Edge Cloud 2 (EC2) is a molecular cloud, about 35 pc in size, with one of the largest galactocentric distances known to exist in the Milky Way. We present observations of a peak CO emission region in the cloud and use these to determine its physical characteristics. We calculate a gas temperature of 20 K and a density of n(H2)~10^4 cm-3. Based on our CO maps, we estimate the mass of EC2 at around 10^4 Msolar and continuum observations suggest a dust-to-gas mass ratio as low as 0.001. Chemical models have been developed to reproduce the abundances in EC2, and they indicate that heavy element abundances may be reduced by a factor of 5 relative to the solar neighborhood (similar to dwarf irregular galaxies and damped Lya systems), very low extinction (A_V <4 mag) due to a very low dust-to-gas mass ratio, an enhanced cosmic-ray ionization rate, and a higher UV field compared to local interstellar values. The reduced abundances may be attributed to the low level of star formation in this region and are probably also related to the continuing infall of primordial (or low-metallicity) halo gas since the Milky Way formed. Finally, we note that shocks from the old supernova remnant GSH 138-01-94 may have determined the morphology and dynamics of EC2.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tris-chelate 5-hydroxymethyl-2,2 '-bipyridine complexes of ruthenium (II) and the structurally related benzo- and naphthoesters have been isolated. The mer-isomer of the alcohol functionalised complex has been isolated by selective precipitation from methylene chloride and was subsequently functionalised to the benzoester with retention of the geometrical isomerism. The fac- and merisomeric forms of the ester complexes were separated using preparative plate silica chromatography and characterised by H-1 NMR spectroscopy. X-ray structural analysis of the fac-isomer of both the ester complexes confirmed the product assignment. The photophysical properties of the three isomers were investigated, indicating very similar absorption spectra to [Ru(biPY)(3)](2+). The emission wavelength was comparable in each case, with the aromatic ester complexes giving a much longer lifetime and higher quantum yields. (c) 2004 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis of three new homoleptic trischelate ruthenium( II) complexes bearing new 2,2'-bipyridine ligands, 5,5'-dibenzylamido-2,2'-bipyridine (L1) and 5-benzylamido-2,2'- bipyridine (L2) has been achieved. In the case of [Ru(L2)(3)](2+), the mer and fac isomers have been separated. H-1 NMR spectroscopic anion binding studies indicate that the two C-3-symmetric pockets provided by [ Ru(L1)(3)](2+) is conducive to receive a range of anions, although this is not readily reflected in the photophysical behaviour. The fac-isomer of [Ru(L2)(3)](2+) does appear to have an enhancement in the binding interactions over the mer form with dihydrogenphosphate salts, although the difference is much less marked with the spherical chloride ions. From X-ray crystallographic evidence, the ability to hold water in the "anion" binding cleft can inhibit the strength of the interactions with anions, giving rise to the observed selectivity for directional oxoanions such as dihydrogen phosphate.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We present a multimodal detection and tracking algorithm for sensors composed of a camera mounted between two microphones. Target localization is performed on color-based change detection in the video modality and on time difference of arrival (TDOA) estimation between the two microphones in the audio modality. The TDOA is computed by multiband generalized cross correlation (GCC) analysis. The estimated directions of arrival are then postprocessed using a Riccati Kalman filter. The visual and audio estimates are finally integrated, at the likelihood level, into a particle filter (PF) that uses a zero-order motion model, and a weighted probabilistic data association (WPDA) scheme. We demonstrate that the Kalman filtering (KF) improves the accuracy of the audio source localization and that the WPDA helps to enhance the tracking performance of sensor fusion in reverberant scenarios. The combination of multiband GCC, KF, and WPDA within the particle filtering framework improves the performance of the algorithm in noisy scenarios. We also show how the proposed audiovisual tracker summarizes the observed scene by generating metadata that can be transmitted to other network nodes instead of transmitting the raw images and can be used for very low bit rate communication. Moreover, the generated metadata can also be used to detect and monitor events of interest.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this study, we describe, for the first time, the synthesis and photophysical and microbiological investigation of ruthenium trischelate diimine complexes designed so as to possess properties specifically suited for use in Photodynamic antimicrobial chemotherapy (PACT). Of the three compounds investigated, one ([Ru(dmob)(3)]Cl-2) has demonstrated considerable promise as a photosensitiser for use in PACT. As a result, this compound is now the subject of comprehensive chemical, toxicological and formulation studies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The presence of paralytic shellfish poisoning (PSP), diarrheic shellfish poisoning (DSP) and amnesic shellfish poisoning (ASP) toxins in seafood is a severe and growing threat to human health. In order to minimize the risks of human exposure, the maximum content of these toxins in seafood has been limited by legal regulations worldwide. The regulated limits are established in equivalents of the main representatives of the groups: saxitoxin (STX), okadaic acid (OA) and domoic acid (DA), for PSP, DSP and ASP, respectively. In this study a multi-detection method to screen shellfish samples for the presence of these toxins simultaneously was developed. Multiplexing was achieved using a solid-phase microsphere assay coupled to flow-fluorimetry detection, based on the Luminex xMap technology. The multi-detection method consists of three simultaneous competition immunoassays. Free toxins in solution compete with STX, OA or DA immobilized on the surface of three different classes of microspheres for binding to specific monoclonal antibodies. The IC50 obtained in buffer was similar in single- and multi-detection: 5.6 ± 1.1 ng/mL for STX, 1.1 ± 0.03 ng/mL for OA and 1.9 ± 0.1 ng/mL for DA. The sample preparation protocol was optimized for the simultaneous extraction of STX, OA and DA with a mixture of methanol and acetate buffer. The three immunoassays performed well with mussel and scallop matrixes displaying adequate dynamic ranges and recovery rates (around 90 % for STX, 80 % for OA and 100 % for DA). This microsphere-based multi-detection immunoassay provides an easy and rapid screening method capable of detecting simultaneously in the same sample three regulated groups of marine toxins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this paper, our previous work on Principal Component Analysis (PCA) based fault detection method is extended to the dynamic monitoring and detection of loss-of-main in power systems using wide-area synchrophasor measurements. In the previous work, a static PCA model was built and verified to be capable of detecting and extracting system faulty events; however the false alarm rate is high. To address this problem, this paper uses a well-known ‘time lag shift’ method to include dynamic behavior of the PCA model based on the synchronized measurements from Phasor Measurement Units (PMU), which is named as the Dynamic Principal Component Analysis (DPCA). Compared with the static PCA approach as well as the traditional passive mechanisms of loss-of-main detection, the proposed DPCA procedure describes how the synchrophasors are linearly
auto- and cross-correlated, based on conducting the singular value decomposition on the augmented time lagged synchrophasor matrix. Similar to the static PCA method, two statistics, namely T2 and Q with confidence limits are calculated to form intuitive charts for engineers or operators to monitor the loss-of-main situation in real time. The effectiveness of the proposed methodology is evaluated on the loss-of-main monitoring of a real system, where the historic data are recorded from PMUs installed in several locations in the UK/Ireland power system.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

As an important type of spatial keyword query, the m-closest keywords (mCK) query finds a group of objects such that they cover all query keywords and have the smallest diameter, which is defined as the largest distance between any pair of objects in the group. The query is useful in many applications such as detecting locations of web resources. However, the existing work does not study the intractability of this problem and only provides exact algorithms, which are computationally expensive.

In this paper, we prove that the problem of answering mCK queries is NP-hard. We first devise a greedy algorithm that has an approximation ratio of 2. Then, we observe that an mCK query can be approximately answered by finding the circle with the smallest diameter that encloses a group of objects together covering all query keywords. We prove that the group enclosed in the circle can answer the mCK query with an approximation ratio of 2 over 3. Based on this, we develop an algorithm for finding such a circle exactly, which has a high time complexity. To improve efficiency, we propose another two algorithms that find such a circle approximately, with a ratio of 2 over √3 + ε. Finally, we propose an exact algorithm that utilizes the group found by the 2 over √3 + ε)-approximation algorithm to obtain the optimal group. We conduct extensive experiments using real-life datasets. The experimental results offer insights into both efficiency and accuracy of the proposed approximation algorithms, and the results also demonstrate that our exact algorithm outperforms the best known algorithm by an order of magnitude.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.