47 resultados para Duplex circulator
Resumo:
Phenotypic identification of Gram-negative bacteria from respiratory specimens of patients with cystic fibrosis carries a high risk of misidentification. Molecular identification techniques that use single-gene targets are also susceptible to error, including cross-reaction issues with other Gram-negative organisms. In this study, we have designed a Pseudomonas aeruginosa duplex real-time polymerase chain reaction (PCR) (PAduplex) assay targeting the ecfX and the gyrB genes. The PAduplex was evaluated against a panel of 91 clinical and environmental isolates that were presumptively identified as P. aeruginosa. The results were compared with those obtained using a commercial biochemical identification kit and several other P. aeruginosa PCR assays. The results showed that the PAduplex assay is highly suitable for routine identification of P. aeruginosa isolates from clinical or environmental samples. The 2-target format provides simultaneous confirmation of P. aeruginosa identity where both the ecfX and gyrB PCR reactions are positive and may also reduce the potential for false negatives caused by sequence variation in primer or probe targets.
Resumo:
In this paper, we propose cyclic prefix single carrier (CP-SC) full-duplex transmission in cooperative spectrum sharing to achieve multipath diversity gain and full-duplex spectral efficiency. Integrating full-duplex transmission into cooperative spectrum sharing systems results in two intrinsic problems: 1) the peak interference power constraint at the PUs are concurrently inflicted on the transmit power at the secondary source (SS) and the secondary relays (SRs); and 2) the residual loop interference occurs between the transmit and the receive antennas at the secondary relays. Thus, examining the effects of residual loop interference under peak interference power constraint at the primary users and maximum transmit power constraints at the SS and the SRs is a particularly challenging problem in frequency selective fading channels. To do so, we derive and quantitatively evaluate the exact and the asymptotic outage probability for several relay selection policies in frequency selective fading channels. Our results manifest that a zero diversity gain is obtained with full-duplex.
Resumo:
Schistosomiasis is a chronically debilitating helminth infection with a significant socio-economic and public health impact. Accurate diagnostics play a pivotal role in achieving current schistosomiasis control and elimination goals. However, many of the current diagnostic procedures, which rely on detection of schistosome eggs, have major limitations including lack of accuracy and the inability to detect pre-patent infections. DNA-based detection methods provide a viable alternative to the current tests commonly used for schistosomiasis diagnosis. Here we describe the optimisation of a novel droplet digital PCR (ddPCR) duplex assay for the diagnosis of Schistosoma japonicum infection which provides improved detection sensitivity and specificity. The assay involves the amplification of two specific and abundant target gene sequences in S. japonicum; a retrotransposon (SjR2) and a portion of a mitochondrial gene (nad1). The assay detected target sequences in different sources of schistosome DNA isolated from adult worms, schistosomules and eggs, and exhibits a high level of specificity, thereby representing an ideal tool for the detection of low levels of parasite DNA in different clinical samples including parasite cell free DNA in the host circulation and other bodily fluids. Moreover, being quantitative, the assay can be used to determine parasite infection intensity and, could provide an important tool for the detection of low intensity infections in low prevalence schistosomiasis-endemic areas.
Resumo:
We propose cyclic prefix single carrier full-duplex transmission in amplify-and-forward cooperative spectrum sharing networks to achieve multipath diversity and full-duplex spectral efficiency. Integrating full-duplex transmission into cooperative spectrum sharing systems results in two intrinsic problems: 1) the residual loop interference occurs between the transmit and the receive antennas at the secondary relays and 2) the primary users simultaneously suffer interference from the secondary source (SS) and the secondary relays (SRs). Thus, examining the effects of residual loop interference under peak interference power constraint at the primary users and maximum transmit power constraints at the SS and the SRs is a particularly challenging problem in frequency selective fading channels. To do so, we derive and quantitatively compare the lower bounds on the outage probability and the corresponding asymptotic outage probability for max–min relay selection, partial relay selection, and maximum interference relay selection policies in frequency selective fading channels. To facilitate comparison, we provide the corresponding analysis for half-duplex. Our results show two complementary regions, named as the signal-to-noise ratio (SNR) dominant region and the residual loop interference dominant region, where the multipath diversity and spatial diversity can be achievable only in the SNR dominant region, however the diversity gain collapses to zero in the residual loop interference dominant region.
Resumo:
In this paper, we propose three relay selection schemes for full-duplex heterogeneous networks in the presence of multiple cognitive radio eavesdroppers. In this setup, the cognitive small-cell nodes (secondary network) can share the spectrum licensed to the macro-cell system (primary network) on the condition that the quality-of-service of the primary network is always satisfied subjected to its outage probability constraint. The messages are delivered from one small-cell base station to the destination with the help of full-duplex small-cell base stations, which act as relay nodes. Based on the availability of the network’s channel state information at the secondary information source, three different selection criteria for full-duplex relays, namely: 1) partial relay selection; 2) optimal relay selection; and 3) minimal self-interference relay selection, are proposed. We derive the exact closed-form and asymptotic expressions of the secrecy outage probability for the three criteria under the attack of non-colluding/colluding eavesdroppers. We demonstrate that the optimal relay selection scheme outperforms the partial relay selection and minimal self-interference relay selection schemes at the expense of acquiring full channel state information knowledge. In addition, increasing the number of the full-duplex small-cell base stations can improve the security performance. At the illegitimate side, deploying colluding eavesdroppers and increasing the number of eavesdroppers put the confidential information at a greater risk. Besides, the transmit power and the desire outage probability of the primary network have great influences on the secrecy outage probability of the secondary network.
Resumo:
We consider a multipair relay channel, where multiple sources communicate with multiple destinations with the help of a full-duplex (FD) relay station (RS). All sources and destinations have a single antenna, while the RS is equipped with massive arrays. We assume that the RS estimates the channels by using training sequences transmitted from sources and destinations. Then, it uses maximum-ratio combining/maximum-ratio transmission (MRC/MRT) to process the signals. To significantly reduce the loop interference (LI) effect, we propose two massive MIMO processing techniques: i) using a massive receive antenna array; or ii) using a massive transmit antenna array together with very low transmit power at the RS. We derive an exact achievable rate in closed-form and evaluate the system spectral efficiency. We show that, by doubling the number of antennas at the RS, the transmit power of each source and of the RS can be reduced by 1.5 dB if the pilot power is equal to the signal power and by 3 dB if the pilot power is kept fixed, while maintaining a given quality-of-service. Furthermore, we compare FD and half-duplex (HD) modes and show that FD improves significantly the performance when the LI level is low.
Resumo:
This work combines microscopy, synchrotron radiation X-ray diffraction, differential scanning calorimetry and thermodynamic calculations in the characterisation of phase transformation behaviour of a Ti–46Al–1.9Cr–3Nb alloy upon continuous heating at constant rates. It has been found that the Ti–46Al–1.9Cr–3Nb alloy after being forged at 1200 °C without further treatment has a duplex microstructure consisting of fine equiaxed and lamellar ? grains with a small amount of a2 plates and particles and about 1 wt.% B2 phase. Differential scanning calorimetry revealed reproducibly several thermal effects upon heating of the as-forged alloy. These thermal effects are related to the equilibration and homogenisation of the sample, change of phase ratios between a2, ? and B2 phases in particular the increase of B2 in respect to a2 and ?, and the following five phase transformations: a2 + ? + B2 a + ? + B2, a + ? + B2 a + ?, ? + a a, a a + ß, a + ß a + ß + L. The observation of these transformations by differential scanning calorimetry is largely in agreement with literature phase diagrams and thermodynamic calculations, though care is needed to consider the different alloy compositions. Kinetics of the ? + a a phase transformation in the Ti–46Al–1.9Cr–3Nb alloy has been quantitatively derived from the calorimetry data, giving phase compositions at any point during the transformation upon continuous heating.
Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase
Resumo:
Severe acute respiratory syndrome coronavirus (SARS-CoV), a newly identified group 2 coronavirus, is the causative agent of severe acute respiratory syndrome, a life-threatening form of pneumonia in humans. Coronavirus replication and transcription are highly specialized processes of cytoplasmic RNA synthesis that localize to virus-induced membrane structures and were recently proposed to involve a complex enzymatic machinery that, besides RNA-dependent RNA polymerase, helicase, and protease activities, also involves a series of RNA-processing enzymes that are not found in most other RNA virus families. Here, we characterized the enzymatic activities of a recombinant form of the SARS-CoV helicase (nonstructural protein [nsp] 13), a superfamily 1 helicase with an N-terminal zinc-binding domain. We report that nsp13 has both RNA and DNA duplex-unwinding activities. SARS-CoV nsp13 unwinds its substrates in a 5'-to-3' direction and features a remarkable processivity, allowing efficient strand separation of extended regions of double-stranded RNA and DNA. Characterization of the nsp13-associated (deoxy)nucleoside triphosphatase ([dNTPase) activities revealed that all natural nucleotides and deoxynucleotides are substrates of nsp13, with ATP, dATP, and GTP being hydrolyzed slightly more efficiently than other nucleotides. Furthermore, we established an RNA 5'-triphosphatase activity for the SARS-CoV nsp13 helicase which may be involved in the formation of the 5' cap structure of viral RNAs. The data suggest that the (d)NTPase and RNA 5'-triphosphatase activities of nsp13 have a common active site. Finally, we established that, in SARS-CoV-infected Vero E6 cells, nsp13 localizes to membranes that appear to be derived from the endoplasmic reticulum and are the likely site of SARS-CoV RNA synthesis.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
A novel anthracene-tagged oligonucleotide can discriminate between a fully-matched DNA target sequence and one with a single mismatching base-pair through a remarkable difference in fluorescence emission intensity upon duplex formation.
Resumo:
The arterivirus equine arteritis virus nonstructural protein 10 (nsp10) has previously been predicted to contain a Zn finger structure linked to a superfamily 1 (SF1) helicase domain. A recombinant form of nsp10, MBP-nsp10, was produced in Escherichia coli as a fusion protein with the maltose-binding protein. The protein was partially purified by affinity chromatography and shown to have ATPase activity that was strongly stimulated by poly(dT), poly(U), and poly(dA) but not by poly(G). The protein also had both RNA and DNA duplex-unwinding activities that required the presence of 5' single-stranded regions on the partial-duplex substrates, indicating a 5'-to-3' polarity in the unwinding reaction. Results of this study suggest a close functional relationship between the arterivirus nsp10 and the coronavirus helicase, for which NTPase and duplex-unwinding activities were recently demonstrated. In a number of biochemical properties, both arterivirus and coronavirus SF1 helicases differ significantly from the previously characterized RNA virus SF1 and SF2 enzymes. Thus, the combined data strongly support the idea that nidovirus helicases may represent a separate group of RNA virus-encoded helicases with distinct properties.
Resumo:
This paper details the implementation and operational performance of a minimum-power 2.45-GHz pulse receiver and a companion on-off keyed transmitter for use in a semi-active duplex RF biomedical transponder. A 50-Ohm microstrip stub-matched zero-bias diode detector forms the heart of a body-worn receiver that has a CMOS baseband amplifier consuming 20 microamps from +3 V and achieves a tangential sensitivity of -53 dBm. The base transmitter generates 0.5 W of peak RF output power into 50 Ohms. Both linear and right-hand circularly polarized Tx-Rx antenna sets were employed in system reliability trials carried out in a hospital Coronary Care Unit, For transmitting antenna heights between 0.3 and 2.2 m above floor level, transponder interrogations were 95% reliable within the 67-m-sq area of the ward, falling to an average of 46 % in the surrounding rooms and corridors. Overall, the circular antenna set gave the higher reliability and lower propagation power decay index.
Resumo:
Structure-based modeling methods have been used to design a series of disubstituted triazole-linked acridine compounds with selectivity for human telomeric quadruplex DNAs. A focused library of these compounds was prepared using click chemistry and the selectivity concept was validated against two promoter quadruplexes from the c-kit gene with known molecular structures, as well as with duplex DNA using a FRET-based melting method. Lead compounds were found to have reduced effects on the thermal stability of the c-kit quadruplexes and duplex DNA structures. These effects were further explored with a series of competition experiments, which confirmed that binding to duplex DNA is very low even at high duplex:telomeric quadruplex ratios. Selectivity to the c-kit quadruplexes is more complex, with some evidence of their stabilization at increasing excess over human telomeric quadruplex DNA. Selectivity is a result of the dimensions of the triazole-acridine compounds; and in particular the separation of the two alkyl-amino terminal groups. Both lead compounds also have selective inhibitory effects on the proliferation of cancer cell lines compared to a normal cell line, and one has been shown to inhibit the activity of the telomerase enzyme, which is selectively expressed in tumor cells, where it plays a role in maintaining telomere integrity and cellular immortalization.
Resumo:
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
Resumo:
We report a novel class of biaryl polyamides highly selective for G-quadruplex DNA, and with significant cytotoxicity in several cancer cell lines; they form planar U-shaped structures that match the surface area dimensions of a terminal G-quartet in quadruplex structures rather than the grooves of duplex DNA.