Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase

Severe acute respiratory syndrome coronavirus (SARS-CoV), a newly identified group 2 coronavirus, is the causative agent of severe acute respiratory syndrome, a life-threatening form of pneumonia in humans. Coronavirus replication and transcription are highly specialized processes of cytoplasmic RNA synthesis that localize to virus-induced membrane structures and were recently proposed to involve a complex enzymatic machinery that, besides RNA-dependent RNA polymerase, helicase, and protease activities, also involves a series of RNA-processing enzymes that are not found in most other RNA virus families. Here, we characterized the enzymatic activities of a recombinant form of the SARS-CoV helicase (nonstructural protein [nsp] 13), a superfamily 1 helicase with an N-terminal zinc-binding domain. We report that nsp13 has both RNA and DNA duplex-unwinding activities. SARS-CoV nsp13 unwinds its substrates in a 5'-to-3' direction and features a remarkable processivity, allowing efficient strand separation of extended regions of double-stranded RNA and DNA. Characterization of the nsp13-associated (deoxy)nucleoside triphosphatase ([dNTPase) activities revealed that all natural nucleotides and deoxynucleotides are substrates of nsp13, with ATP, dATP, and GTP being hydrolyzed slightly more efficiently than other nucleotides. Furthermore, we established an RNA 5'-triphosphatase activity for the SARS-CoV nsp13 helicase which may be involved in the formation of the 5' cap structure of viral RNAs. The data suggest that the (d)NTPase and RNA 5'-triphosphatase activities of nsp13 have a common active site. Finally, we established that, in SARS-CoV-infected Vero E6 cells, nsp13 localizes to membranes that appear to be derived from the endoplasmic reticulum and are the likely site of SARS-CoV RNA synthesis.

ICln, a novel integrin alpha(11b)beta3-associated protein, functionally regulates platelet activation.

A critical role for the conserved -integrin cytoplasmic motif, KVGFFKR, is recognized in the regulation of activation of the platelet integrin IIb3. To understand the molecular mechanisms of this regulation, we sought to determine the nature of the protein interactions with this cytoplasmic motif. We used a tagged synthetic peptide, biotin-KVGFFKR, to probe a high density protein expression array (37,200 recombinant human proteins) for high affinity interactions. A number of potential integrin-binding proteins were identified. One such protein, a chloride channel regulatory protein, ICln, was characterized further because its affinity for the integrin peptide was highest as was its expression in platelets. We verified the presence of ICln in human platelets by PCR, Western blots, immunohistochemistry, and its co-association with IIb3 by surface plasmon resonance. The affinity of this interaction was 82.2 ± 24.4 nM in a cell free assay. ICln co-immunoprecipitates with IIb3 in platelet lysates demonstrating that this interaction is physiologically relevant. Furthermore, immobilized KVGFFKR peptides, but not control KAAAAAR peptides, specifically extract ICln from platelet lysates. Acyclovir (100 µM to 5 mM), a pharmacological inhibitor of the ICln chloride channel, specifically inhibits integrin activation (PAC-1 expression) and platelet aggregation without affecting CD62 P expression confirming a specific role for ICln in integrin activation. In parallel, a cell-permeable peptide corresponding to the potential integrin-recognition domain on ICln (AKFEEE, 10–100 µM) also inhibits platelet function. Thus, we have identified, verified, and characterized a novel functional interaction between the platelet integrin and ICln, in the platelet membrane.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The Septin-Binding Protein Anillin is Over-Expressed in Diverse Human Tumours

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

Effect of a COL1A1 Sp1 Binding Site Polymorphism on Arterial Pulse Wave Velocity: An Index of Compliance.

Reduced arterial compliance precedes changes in blood pressure, which may be mediated through alterations in vessel wall matrix composition. We investigated the effect of the collagen type I-1 gene (COL1A1) +2046G>T polymorphism on arterial compliance in healthy individuals. We recruited 489 subjects (251 men and 238 women; mean age, 22.6±1.6 years). COL1A1 genotypes were determined using polymerase chain reaction and digestion by restriction enzyme Bal1. Arterial pulse wave velocities were measured in 3 segments, aortoiliac (PWVA), aortoradial (PWVB), and aorto-dorsalis-pedis (PWVF), as an index of compliance using a noninvasive optical method. Data were available for 455 subjects. The sample was in Hardy-Weinberg equilibrium with genotype distributions and allele frequencies that were not significantly different from those reported previously. The T allele frequency was 0.22 (95% confidence interval, 0.19 to 0.24). Two hundred eighty-three (62.2%) subjects were genotype GG, 148 (35.5%) subjects were genotype GT, and 24 (5.3%) subjects were genotype TT. A comparison of GG homozygotes with GT and TT individuals demonstrated a statistically significant association with arterial compliance: PWVF 4.92±0.03 versus 5.06±0.05 m/s (ANOVA, P=0.009), PWVB 4.20±0.03 versus 4.32±0.04 m/s (ANOVA, P=0.036), and PWVA 3.07±0.03 versus 3.15±0.03 m/s (ANOVA, P=0.045). The effects of genotype were independent of age, gender, smoking, mean arterial pressure, body mass index, family history of hypertension, and activity scores. We report an association between the COL1A1 gene polymorphism and arterial compliance. Alterations in arterial collagen type 1A deposition may play a role in the regulation of arterial compliance

Assocation Between Variation in the Actin-Binding Gene Caldesmon and Diabetic Nephropathy in Type 1 Diabetes

Dysfunction of the actin cytoskeleton is a key event in the pathogenesis of diabetic nephropathy. We previously reported that certain cytoskeletal genes are upregulated in mesangial cells exposed to a high extracellular glucose concentration. One such gene, caldesmon, lies on chromosome 7q35, a region linked to nephropathy in family studies, making it a candidate susceptibility gene for diabetic nephropathy. We screened all exons, untranslated regions, and a 5-kb region upstream of the gene for variation using denaturing high-performance liquid chromatography technology. An A>G single nucleotide polymorphism (SNP) at position -579 in the promoter region was associated with nephropathy in a case-control study using 393 type 1 diabetic patients from Northern Ireland (odds ratio [OR] 1.38, 95% CI 1.02–1.86, P = 0.03). A similar trend was found in an independent sample from a second center. When the sample groups were combined (n = 606), the association between the -579G allele and nephropathy remained significant (OR 1.35, 1.07–1.70, P = 0.01). The haplotype structure in the surrounding 7-kb region was determined. No single haplotype was more strongly associated with nephropathy than the -579A>G SNP. These results suggest a role for the caldesmon gene in susceptibility to diabetic nephropathy in type 1 diabetes.

CD33 reponses are blocked by SOCS3 through accelerated proteasomal-mediated turnover

CD33 is a member of the sialic acid–binding immunoglobulin-like lectin (Siglec) family of inhibitory receptors and a therapeutic target for acute myeloid leukemia (AML). CD33 contains a cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM), which can recruit SHP-1 and SHP-2. How CD33 expression is regulated is unclear. Suppressor of cytokine signaling 3 (SOCS3) is expressed in response to cytokines, LPS, and other PAMPs, and competes with SHP-1/2 binding to ITIMs of cytokine receptors, thereby inhibiting signaling. In this study, using peptide pull-down experiments, we found that SOCS3 can specifically bind to the phosphorylated ITIM of CD33. Additionally, following cross-linking SOCS3 can recruit the ECS E3 ligase resulting in accelerated proteasomal degradation of both CD33 and SOCS3. Our data suggest that the tyrosine motifs in CD33 are not important for internalization, while they are required for degradation. Moreover, SOCS3 inhibited the CD33-induced block on cytokine-induced proliferation. This is the first receptor shown to be degraded by SOCS3 and where SOCS3 and its target protein are degraded concomitantly. Our findings clearly suggest that during an inflammatory response, the inhibitory receptor CD33 is lost by this mechanism. Moreover, this has important clinical implications as tumors expressing SOCS3 may be refractory to -CD33 therapy.

Relevance of heterometallic binding energy for metal underpotential deposition

We present first-principles calculations for a number of metals adsorbed on several different metallic substrates. Some of these systems are very relevant in electrochemistry, especially in the field of underpotential deposition phenomena. The present studies reveal the existence of a relationship between the excess binding energy and the surface energy difference between substrate and adsorbate. Comparisons with experimental underpotential shifts show that excess binding energies are systematically underestimated. By analyzing experimental information on different systems, we conclude that this discrepancy between our vacuum calculations and experiments carried out in an electrolytic solution is likely to be due to anion adsorption and/or solvent effects.

Tight-binding simulation of current-carrying nanostructures

The tight-binding (TB) approach to the modelling of electrical conduction in small structures is introduced. Different equivalent forms of the TB expression for the electrical current in a nanoscale junction are derived. The use of the formalism to calculate the current density and local potential is illustrated by model examples. A first-principles time-dependent TB formalism for calculating current-induced forces and the dynamical response of atoms is presented. An earlier expression for current-induced forces under steady-state conditions is generalized beyond local charge neutrality and beyond orthogonal TB. Future directions in the modelling of power dissipation and local heating in nanoscale conductors are discussed.

Time-dependent tight binding

Starting from a Lagrangian mean-field theory, a set of time-dependent tight-binding equations is derived to describe dynamically and self-consistently an interacting system of quantum electrons and classical nuclei. These equations conserve norm, total energy and total momentum. A comparison with other tight-binding models is made. A previous tight-binding result for forces on atoms in the presence of electrical current flow is generalized to the time-dependent domain and is taken beyond the limit of local charge neutrality.