222 resultados para Covalent binding


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reduced arterial compliance precedes changes in blood pressure, which may be mediated through alterations in vessel wall matrix composition. We investigated the effect of the collagen type I-1 gene (COL1A1) +2046G>T polymorphism on arterial compliance in healthy individuals. We recruited 489 subjects (251 men and 238 women; mean age, 22.6±1.6 years). COL1A1 genotypes were determined using polymerase chain reaction and digestion by restriction enzyme Bal1. Arterial pulse wave velocities were measured in 3 segments, aortoiliac (PWVA), aortoradial (PWVB), and aorto-dorsalis-pedis (PWVF), as an index of compliance using a noninvasive optical method. Data were available for 455 subjects. The sample was in Hardy-Weinberg equilibrium with genotype distributions and allele frequencies that were not significantly different from those reported previously. The T allele frequency was 0.22 (95% confidence interval, 0.19 to 0.24). Two hundred eighty-three (62.2%) subjects were genotype GG, 148 (35.5%) subjects were genotype GT, and 24 (5.3%) subjects were genotype TT. A comparison of GG homozygotes with GT and TT individuals demonstrated a statistically significant association with arterial compliance: PWVF 4.92±0.03 versus 5.06±0.05 m/s (ANOVA, P=0.009), PWVB 4.20±0.03 versus 4.32±0.04 m/s (ANOVA, P=0.036), and PWVA 3.07±0.03 versus 3.15±0.03 m/s (ANOVA, P=0.045). The effects of genotype were independent of age, gender, smoking, mean arterial pressure, body mass index, family history of hypertension, and activity scores. We report an association between the COL1A1 gene polymorphism and arterial compliance. Alterations in arterial collagen type 1A deposition may play a role in the regulation of arterial compliance

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dysfunction of the actin cytoskeleton is a key event in the pathogenesis of diabetic nephropathy. We previously reported that certain cytoskeletal genes are upregulated in mesangial cells exposed to a high extracellular glucose concentration. One such gene, caldesmon, lies on chromosome 7q35, a region linked to nephropathy in family studies, making it a candidate susceptibility gene for diabetic nephropathy. We screened all exons, untranslated regions, and a 5-kb region upstream of the gene for variation using denaturing high-performance liquid chromatography technology. An A>G single nucleotide polymorphism (SNP) at position -579 in the promoter region was associated with nephropathy in a case-control study using 393 type 1 diabetic patients from Northern Ireland (odds ratio [OR] 1.38, 95% CI 1.02–1.86, P = 0.03). A similar trend was found in an independent sample from a second center. When the sample groups were combined (n = 606), the association between the -579G allele and nephropathy remained significant (OR 1.35, 1.07–1.70, P = 0.01). The haplotype structure in the surrounding 7-kb region was determined. No single haplotype was more strongly associated with nephropathy than the -579A>G SNP. These results suggest a role for the caldesmon gene in susceptibility to diabetic nephropathy in type 1 diabetes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present first-principles calculations for a number of metals adsorbed on several different metallic substrates. Some of these systems are very relevant in electrochemistry, especially in the field of underpotential deposition phenomena. The present studies reveal the existence of a relationship between the excess binding energy and the surface energy difference between substrate and adsorbate. Comparisons with experimental underpotential shifts show that excess binding energies are systematically underestimated. By analyzing experimental information on different systems, we conclude that this discrepancy between our vacuum calculations and experiments carried out in an electrolytic solution is likely to be due to anion adsorption and/or solvent effects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The tight-binding (TB) approach to the modelling of electrical conduction in small structures is introduced. Different equivalent forms of the TB expression for the electrical current in a nanoscale junction are derived. The use of the formalism to calculate the current density and local potential is illustrated by model examples. A first-principles time-dependent TB formalism for calculating current-induced forces and the dynamical response of atoms is presented. An earlier expression for current-induced forces under steady-state conditions is generalized beyond local charge neutrality and beyond orthogonal TB. Future directions in the modelling of power dissipation and local heating in nanoscale conductors are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Starting from a Lagrangian mean-field theory, a set of time-dependent tight-binding equations is derived to describe dynamically and self-consistently an interacting system of quantum electrons and classical nuclei. These equations conserve norm, total energy and total momentum. A comparison with other tight-binding models is made. A previous tight-binding result for forces on atoms in the presence of electrical current flow is generalized to the time-dependent domain and is taken beyond the limit of local charge neutrality.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe an empirical, self-consistent, orthogonal tight-binding model for zirconia, which allows for the polarizability of the anions at dipole and quadrupole levels and for crystal field splitting of the cation d orbitals, This is achieved by mixing the orbitals of different symmetry on a site with coupling coefficients driven by the Coulomb potentials up to octapole level. The additional forces on atoms due to the self-consistency and polarizabilities are exactly obtained by straightforward electrostatics, by analogy with the Hellmann-Feynman theorem as applied in first-principles calculations. The model correctly orders the zero temperature energies of all zirconia polymorphs. The Zr-O matrix elements of the Hamiltonian, which measure covalency, make a greater contribution than the polarizability to the energy differences between phases. Results for elastic constants of the cubic and tetragonal phases and phonon frequencies of the cubic phase are also presented and compared with some experimental data and first-principles calculations. We suggest that the model will be useful for studying finite temperature effects by means of molecular dynamics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The first definitive high-resolution single-crystal X-ray structure for the coordination of the 1-methylimidazole (Meimid) ligand to UO2(Ac)2 (Ac = CH3CO2) is reported. The crystal structure evidence is confirmed by IR, Raman, and UV-vis spectroscopic data. Direct participation of the nitrogen atom of the Meimid ligand in binding to the uranium center is confirmed. Structural analysis at the DFT (B3LYP) level of theory showed a conformational difference of the Meimid ligand in the free gas-phase complex versus the solid state due to small energetic differences and crystal packing effects. Energetic analysis at the MP2 level in the gas phase supported stronger Meimid binding over H2O binding to both UO2(Ac)2 and UO2(NO3)2. In addition, self-consistent reaction field COSMO calculations were used to assess the aqueous phase energetics of combination and displacement reactions involving H2O and Meimid ligands to UO2R2 (R = Ac, NO3). For both UO2(NO3)2 and UO2(Ac)2, the displacement of H2O by Meimid was predicted to be energetically favorable, consistent with experimental results that suggest Meimid may bind uranyl at physiological pH. Also, log(Knitrate/KAc) calculations supported experimental evidence that the binding stoichiometry of the Meimid ligand is dependent upon the nature of the reactant uranyl complex. These results clearly demonstrate that imidazole binds to uranyl and suggest that binding of histidine residues to uranyl could occur under normal biological conditions.