PRL-3 activates mTORC1 in Cancer Progression

PRL-3, a metastasis-associated phosphatase, is known to exert its oncogenic functions through activation of PI3K/Akt, which is a key regulator of the rapamycin-sensitive mTOR complex 1 (mTORC1), but a coherent link between PRL-3 and activation of mTOR has not yet been formally demonstrated. We report a positive correlation between PRL-3 expression and mTOR phospho-activation in clinical tumour samples and mouse models of cancer and demonstrate that PRL-3 increased downstream signalling to the mTOR substrates, p70S6K and 4E-BP1, by increasing PI3K/Akt-mediated activation of Rheb-GTP via TSC2 suppression. We also show that PRL-3 increases mTOR translocation to lysosomes via increased mTOR binding affinity to Rag GTPases in an Akt-independent manner, demonstrating a previously undescribed mechanism of action for PRL-3. PRL-3 also enhanced matrix metalloproteinase-2 secretion and cellular invasiveness via activation of mTOR, attributes which were sensitive to rapamycin treatment. The downstream effects of PRL-3 were maintained even under conditions of environmental stress, suggesting that PRL-3 provides a strategic survival advantage to tumour cells via its effects on mTOR.

CD4+ T Cells Targeting Dominant and Cryptic Epitopes from Bacillus anthracis Lethal Factor

Anthrax is an endemic infection in many countries, particularly in the developing world. The causative agent, Bacillus anthracis, mediates disease through the secretion of binary exotoxins. Until recently, research into adaptive immunity targeting this bacterial pathogen has largely focused on the humoral response to these toxins. There is, however, growing recognition that cellular immune responses involving IFNγ producing CD4+ T cells also contribute significantly to a protective memory response. An established concept in adaptive immunity to infection is that during infection of host cells, new microbial epitopes may be revealed, leading to immune recognition of so called 'cryptic' or 'subdominant' epitopes. We analyzed the response to both cryptic and immunodominant T cell epitopes derived from the toxin component lethal factor and presented by a range of HLA-DR alleles. Using IFNγ-ELISpot assays we characterized epitopes that elicited a response following immunization with synthetic peptide and the whole protein and tested their capacities to bind purified HLA-DR molecules in vitro. We found that DR1 transgenics demonstrated T cell responses to a greater number of domain III cryptic epitopes than other HLA-DR transgenics, and that this pattern was repeated with the immunodominant epitopes, as a greater proportion of these epitopes induced a T cell response when presented within the context of the whole protein. Immunodominant epitopes LF457-476 and LF467-487 were found to induce a T cell response to the peptide, as well as to the whole native LF protein in DR1 and DR15, but not in DR4 transgenics. The analysis of Domain I revealed the presence of several unique cryptic epitopes all of which showed a strong to moderate relative binding affinity to HLA-DR4 molecules. However, none of the cryptic epitopes from either domain III or I displayed notably high binding affinities across all HLA-DR alleles assayed. These responses were influenced by the specific HLA alleles presenting the peptide, and imply that construction of future epitope string vaccines which are immunogenic across a wide range of HLA alleles could benefit from a combination of both cryptic and immunodominant anthrax epitopes.

p.(L576P) -KIT mutation in GIST: Favorable prognosis and sensitive to imatinib?

Exon 11 KIT mutations are found in a majority of gastrointestinal stromal tumors (GIST) and are usually predictive of response to imatinib, a KIT, PDGFRA and ABL inhibitor. Exon 11 mutations with poor sensitivity to imatinib and poor outcome can be observed on rare occasions, including p.(L576P). In silico and in vitro studies suggested a decreased binding affinity for imatinib in p.(L576P) KIT mutations, thereby offering an explanation for their poor outcome and poor response to standard therapy. These observations were further corroborated with anecdotal case reports of refractoriness or non-durable response to imatinib therapy. However, we describe the favorable response to imatinib and outcome in 5 p.(L576P)-KIT mutant GIST patients treated at a tertiary sarcoma referral center. The sensitivity of p.(L576P)-KIT mutations to imatinib, and the prognostic impact of this mutation need to be further evaluated in a larger cohort. Based on our observations, p.(L576P) mutated GISTs should be treated with standard first line imatinib therapy.

Comparison and evaluation of the specificity and binding capacity of commercial and in house affinity columns used in sample preparation for analysis of growth-promoting drugs

Immunoaffinity chromatography (IAC) and affinity chromatography (AC:) are widely used for extraction of drugs from biological samples. Fifteen column types were purchased from five different manufacturers and;their ability to bind specific drugs including beta-agonists and anabolic steroids over a range of analyte concentrations in fortified bovine urine samples was assessed. The performance data obtained from these columns were compared with columns produced in this laboratory (in house columns). The in house columns gave the highest recoveries, ranging from 92 to 100% at the 1 ng spiking concentration, for five of the seven analytes assessed. Forty percent (11 of 27) of all the commercial column assessments recorded recoveries of less than 50% even when the lowest spiking concentration was applied (1 ng). For one manufacturer, only one of seven different columns purchased delivered extraction efficiencies greater than 50%. The extraction efficiencies of the clenbuterol columns were the highest with all commercially prepared columns showing at least 50% binding of radiolabelled tracer. Recoveries of alpha-nortestosterone were the lowest. The variability of these products with respect to quality control requires constant monitoring.

The conserved Helix C region in the superfamily of interferon-a/interleukin-10-related cytokines corresponds to a high-affinity binding site for the HSP70 chaperone DnaK.

HSP70 chaperones mediate protein folding by ATP-dependent interaction with short linear peptide segments that are exposed on unfolded proteins. The mode of action of the Escherichia coli homolog DnaK is representative of all HSP70 chaperones, including the endoplasmic reticulum variant BiP/GRP78. DnaK has been shown to be effective in assisting refolding of a wide variety of prokaryotic and eukaryotic proteins, including the -helical homodimeric secretory cytokine interferon- (IFN-). We screened solid-phase peptide libraries from human and mouse IFN- to identify DnaK-binding sites. Conserved DnaK-binding sites were identified in the N-terminal half of helix B and in the C-terminal half of helix C, both of which are located at the IFN- dimer interface. Soluble peptides derived from helices B and C bound DnaK with high affinity in competition assays. No DnaK-binding sites were found in the loops connecting the -helices. The helix C DnaK-binding site appears to be conserved in most members of the superfamily of interleukin (IL)-10-related cytokines that comprises, apart from IL-10 and IFN-, a series of recently discovered small secretory proteins, including IL-19, IL-20, IL-22/IL-TIF, IL-24/MDA-7 (melanoma differentiation-associated gene), IL-26/AK155, and a number of viral IL-10 homologs. These cytokines belong to a relatively small group of homodimeric proteins with highly interdigitated interfaces that exhibit the strongly hydrophobic character of the interior core of a single-chain folded domain. We propose that binding of DnaK to helix C in the superfamily of IL-10-related cytokines may constitute the hallmark of a novel conserved regulatory mechanism in which HSP70-like chaperones assist in the formation of a hydrophobic dimeric "folding" interface.

Structure-based design of selective high-affinity telomeric quadruplex-binding ligands.

A library of triazole-based telomeric quadruplex-selective ligands has been developed that mimic an established family of tri-substituted acridine-based ligands, using crystal structure data as a starting-point for computer-based design. Binding affinities, estimated by electrospray mass spectrometry, are in accord with the design concept.

High-affinity NO(3-)-H+ cotransport in the fungus Neurospora:induction and control by pH and membrane voltage

High-affinity nitrate transport was examined in intact hyphae of Neurospora crassa using electrophysiological recordings to characterize the response of the plasma membrane to NO3- challenge and to quantify transport activity. The NO3(-)-associated membrane current was determined using a three electrode voltage clamp to bring membrane voltage under experimental control and to compensate for current dissipation along the longitudinal cell axis. Nitrate transport was evident in hyphae transferred to NO3(-)-free, N-limited medium for 15 hr, and in hyphae grown in the absence of a nitrogen source after a single 2-min exposure to 100 microM NO3-. In the latter, induction showed a latency of 40-80 min and rose in scalar fashion with full transport activity measurable approx. 100 min after first exposure to NO3-; it was marked by the appearance of a pronounced sensitivity of membrane voltage to extracellular NO3- additions which, after induction, resulted in reversible membrane depolarizations of (+)54-85 mV in the presence of 50 microM NO3-; and it was suppressed when NH4+ was present during the first, inductive exposure to NO3-. Voltage clamp measurements carried out immediately before and following NO3- additions showed that the NO3(-)-evoked depolarizations were the consequence of an inward-directed current that appeared in parallel with the depolarizations across the entire range of accessible voltages (-400 to +100 mV). Measurements of NO3- uptake using NO3(-)-selective macroelectrodes indicated a charge stoichiometry for NO3- transport of 1(+):1(NO3-) with common K(m) and Jmax values around 25 microM and 75 pmol NO3- cm-2sec-1, respectively, and combined measurements of pHo and [NO3-]o showed a net uptake of approx. 1 H+ with each NO3- anion. Analysis of the NO3- current demonstrated a pronounced voltage sensitivity within the normal physiological range between -300 and -100 mV as well as interactions between the kinetic parameters of membrane voltage, pHo and [NO3-]o. Increasing the bathing pH from 5.5 to 8.0 reduced the current and the associated membrane depolarizations 2- to 4-fold. At a constant pHo of 6.1, driving the membrane voltage from -350 to -150 mV resulted in an approx. 3-fold reduction in the maximum current and a 5-fold rise in the apparent affinity for NO3-. By contrast, the same depolarization effected an approx. 20% fall in the K(m) for transport as a function in [H+]o. These, and additional results are consistent with a charge-coupling stoichiometry of 2(H+) per NO3- anion transported across the membrane, and implicate a carrier cycle in which NO3- binding is kinetically adjacent to the rate-limiting step of membrane charge transit. The data concur with previous studies demonstrating a pronounced voltage-dependence to high-affinity NO3- transport system in Arabidopsis, and underline the importance of voltage as a kinetic factor controlling NO3- transport; finally, they distinguish metabolite repression of NO3- transport induction from its sensitivity to metabolic blockade and competition with the uptake of other substrates that draw on membrane voltage as a kinetic substrate.

Mutations within subdomain II of the extracellular region of epidermal growth factor receptor selectively alter TGF alpha binding

The interactions of epidermal growth factor (EGF) and transforming growth factor alpha (TGF alpha) with the epidermal growth factor receptor (EGFR) were examined by insertion mutagenesis of the receptor. Seventeen insertions were made throughout a construct containing only the extracellular domain. This truncated receptor (sEGFR) was secreted and had a dissociation constant similar to that of the full-length solubilized receptor. Receptors with insertions within subdomain III were not secreted. Two receptors with insertions at positions 291 and 474, which border subdomain III, have significantly decreased binding to both EGF and TGF alpha relative to wild type. This confirms previous work demonstrating that subdomain III forms the primary binding site for EGF and TGF alpha. Four of the mutants within subdomain II had a decreased binding to TGF alpha relative to wild type, but had wild type binding to EGF. These results suggest that a region within subdomain II may selectively regulate the binding of TGF alpha. Two receptors which contained insertions within subdomains II and IV, approximately equidistant from the center of subdomain III, bound twofold more ligand molecules than wild type receptor, with an affinity similar to that of wild type receptor. These findings suggest that insertion at these positions allows the access of more than one ligand molecule to the binding site.

Differential affinity of FLIP and procaspase 8 for FADD's DED binding surfaces regulates DISC assembly

Death receptor activation triggers recruitment of FADD, which via its death effector domain (DED) engages the DEDs of procaspase 8 and its inhibitor FLIP to form death-inducing signalling complexes (DISCs). The DEDs of FADD, FLIP and procaspase 8 interact with one another using two binding surfaces defined by α1/α4 and α2/α5 helices, respectively. Here we report that FLIP has preferential affinity for the α1/α4 surface of FADD, whereas procaspase 8 has preferential affinity for FADD's α2/α5 surface. These relative affinities contribute to FLIP being recruited to the DISC at comparable levels to procaspase 8 despite lower cellular expression. Additional studies, including assessment of DISC stoichiometry and functional assays, suggest that following death receptor recruitment, the FADD DED preferentially engages FLIP using its α1/α4 surface and procaspase 8 using its α2/α5 surface; these tripartite intermediates then interact via the α1/α4 surface of FLIP DED1 and the α2/α5 surface of procaspase 8 DED2.

High-affinity NO3 --H+ cotransport in the fungus Neurospora:Induction and control by pH and membrane voltate

High-affinity nitrate transport was examined in intact hyphae of Neurospora crassa using electrophysiological recordings to characterize the response of the plasma membrane to NO₃ ^- challenge and to quantify transport activity. The NO₃ ^--associated membrane current was determined using a three electrode voltage clamp to bring membrane voltage under experimental control and to compensate for current dissipation along the longitudinal cell axis. Nitrate transport was evident in hyphae transferred to NO₃ ^--free, N-limited medium for 15 hr, and in hyphae grown in the absence of a nitrogen source after a single 2-min exposure to 100 μM NO₃ ^-. In the latter, induction showed a latency of 40-80 min and rose in scalar fashion with full transport activity mensurable approx. 100 min after first exposure to NO₃ ^-; it was marked by the appearance of a pronounced sensitivity of membrane voltage to extracellular NO₃ ^- additions which, after induction, resulted in reversible membrane depolarizations of (+)54-85 mV in the presence of 50 μM NO₃ ^-; and it was suppressed when NH₄ ⁺, was present during the first, inductive exposure to NO₃ ^-. Voltage clamp measurements carried out immediately before and following NO₃ ^- additions showed that the NO₃ ^--evoked depolarizations were the consequence of an inward-directed current that appeared in parallel with the depolarizations across the entire range of accessible voltages -400 to +100 mV). Measurements of NO₃ ^- uptake using NO₃ ^--selective macroelectrodes indicated a charge stoichiometry for NO₃ ^- transport of 1(+):1(NO₃ ^-) with common K(m) and J(max) values around 25 μM and 75 pmol NO₃ ^- cm^-2sec^-1, respectively, and combined measurements of pH(o) and [NO₃ ^-](o) showed a net uptake of approx. 1 H⁺ with each NO₃ ^- anion. Analysis of the NO₃ ^- current demonstrated a pronounced voltage sensitivity within the normal physiological range between -300 and -100 mV as well as interactions between the kinetic parameters of membrane voltage, pH(o) and [NO₃ ^-](o). Increasing the bathing pH from 5.5 to 8.0 reduced the current and the associated membrane depolarizations 2- to 4-fold. At a constant pH(o) of 6.1, driving the membrane voltage from -350 to -150 mV resulted in an approx. 3-fold reduction in the maximum current and a 5-fold rise in the apparent affinity for NO₃ ^-. By contrast, the same depolarization effected an approx. 20% fall in the K(m) for transport as a function in [H⁺](o). These, and additional results are consistent with a charge-coupling stoichiometry of 2(H⁺) per NO anion transported across the membrane, and implicate a carrier cycle in which NO binding is kinetically adjacent to the rate-limiting step of membrane charge transit. The data concur with previous studies demonstrating a pronounced voltage-dependence to high-affinity NO₃ ^- transport system in Arabidopsis, and underline the importance of voltage as a kinetic factor controlling NO₃ ^- transport; finally, they distinguish metabolite repression of NO₃ ^- transport induction from its sensitivity to metabolic blockade and competition with the uptake of other substrates that draw on membrane voltage as a kinetic substrate.

Synthesis and Binding of Stable Bisubstrate Ligands for Phosphoglycerate Kinase

Stable bisubstrate ligands of phosphoglycerate kinase (PGK) have been synthesised with AMP or ADP conjugated to hydrolytically-stable, symmetrical analogues of 1,3-bisphosphoglycerate and their binding to yeast PGK evaluated. Their Kds decrease with net negative charge, with a penta-anionic analogue 7 showing highest affinity - in accordance with its approximation to the transition state for the reaction catalysed by PGK.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Mammalian cell production of a respiratory syncytial virus (RSV) candidate vaccine recovered using a product-specific affinity column

The recombinant production of a respiratory syncytial virus (RSV) candidate vaccine BBG2Na in baby hamster kidney cells (BHK-21 cells) was investigated. BBG2Na consists of a serum-albumin-binding region (BB) fused to a 101-amino-acid fragment of the RSV G-protein. Semliki Forest virus-based expression vectors encoding both intracellular and secreted forms of BBG2Na were constructed and found to be functional. Affinity recovery of BBG2Na employing human serum albumin columns was found to be inefficient due to the abundance of BSA in the applied samples. Instead, a strategy using a tailor-made affinity ligand based on a combinatorially engineered Staphylococcus aureus protein A domain, showing specific binding to the G-protein part of the product, was evaluated. In conclusion, a strategy for production and successful recovery of BBG2Na in mammalian cells was created, through the development of a product-specific affinity column.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.