188 resultados para Antioxidant agents
Resumo:
Aims/hypothesis: Abnormalities of glucose and fatty acid metabolism in diabetes are believed to contribute to the development of oxidative stress and the long term vascular complications of the disease therefore the interactions of glucose and long chain fatty acids on free radical damage and endogenous antioxidant defences were investigated in vascular smooth muscle cells. Methods: Porcine vascular smooth muscle cells were cultured in 5 mmol/l or 25 mmol/l glucose for ten days. Fatty acids, stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2) and gamma-linolenic acid (18:3) were added with defatted bovine serum albumin as a carrier for the final three days. Results. Glucose (25 mmol/l) alone caused oxidative stress in the cells as evidenced by free radical-mediated damage to DNA, lipids, and proteins. The addition of fatty acids (0.2 mmol/l) altered the profile of free radical damage; the response was J-shaped with respect to the degree of unsaturation of each acid, and oleic acid was associated with least damage. The more physiological concentration (0.01 mmol/l) of gamma-linolenic acids was markedly different in that, when added to 25 mmol/l glucose it resulted in a decrease in free radical damage to DNA, lipids and proteins. This was due to a marked increase in levels of the antioxidant, glutathione, and increased gene expression of the rate-limiting enzyme in glutathione synthesis, gamma-glutamylcysteine synthetase. Conclusion/Interpretation: The results clearly show that glucose and fatty acids interact in the production of oxidative stress in vascular smooth muscle cells.
Resumo:
AIMS/HYPOTHESIS: To investigate the effect of treatment with the non-steroidal anti-inflammatory drug Sulindac on the early vascular pathology of diabetic retinopathy in the dog, and it's effect on recognised biochemical indices of hyperglycaemia-related pathophysiology. METHODS: Experimental diabetes (streptozotocin/alloxan) was induced in 22 male beagle dogs and 12 of the animals were assigned at random to receive oral Sulindac (10 mg/kg daily). Age- and sex-matched control animals were maintained as non-diabetic controls. After 4 years, several morphological parameters were quantified in the retinal microvasculature of each animal group using an established stereological method. Also, the following diabetes-associated biochemical parameters were analysed: accumulation of advanced glycation end products (AGEs), red blood cell polyol levels and antioxidant status. RESULTS: Diabetes increased red blood cell sorbitol levels when compared to non-diabetic controls (p<or =0.05), however, there was no difference in sorbitol levels between the untreated and the treated diabetic animals. No significant differences were found in red blood cell myoinositol levels between the three groups of animals. Pentosidine and other AGEs were increased two- to three-fold in the diabetic animals (p<or =0.001) although treatment with Sulindac did not affect their accumulation in diabetic skin collagen or alter diabetes-induced rises in plasma malondialdehyde. Retinal capillary basement membrane volume was significantly increased in the untreated diabetic dogs compared to non-diabetic controls or Sulindac-treated diabetic animals (p<or =0.0001). CONCLUSION/INTERPRETATION: This study has confirmed the beneficial effect of a non-steroidal anti-inflammatory drug on the early vascular pathology of diabetic retinopathy. However the treatment benefit was not dependent on inhibition of polyol pathway activity, advanced glycation, or oxidative stress.
Resumo:
BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.