A metal complex that imitates a micelle

A metal complex with a micelle-like, core-shell structure adopts higher nuclearity in water than in organic solvents, thereby imitating also the growth of a micelle, but through covalent rather than non-covalent aggregation.

The first structural characterization of a [2.2]PHANEPHOS - Transition-metal complex: Structure of rac-[Pd(4,12-bis(diphenylphosphino)[2.2]paracyclophane)Cl-2]

The solid-state structure of the [2.2]PHANEPHOS-transition-metal complex rac-[Pd(4,12-bis(diphenylphosphino)[2.2]paracyclophane)Cl-2] has been established by single-crystal X-ray diffraction. The P-Pd-P bite angle is ideally suited to catalytic processes such as carbon-carbon cross-coupling reactions, which involve reductive elimination as the rate-determining step.

Enantioselective Assembly of a Ruthenium(II) Polypyridyl Complex into a Double Helix

Evolution can increase the complexity of matter by self-organization into helical architectures, the best example being the DNA double helix. One common aspect, apparently shared by most of these architectures, is the presence of covalent bonds within the helix backbone. Here, we report the unprecedented crystal structures of a metal complex that self-organizes into a continuous double helical structure, assembled by non-covalent building blocks. Built up solely by weak stacking interactions, this alternating tread stairs-like double helical assembly mimics the DNA double helix structure. Starting from a racemic mixture in aqueous solution, the ruthenium(II) polypyridyl complex forms two polymorphic structures of a left-handed double helical assembly of only the Λ-enantiomer. The stacking of the helices is different in both polymorphs: a crossed woodpile structure versus a parallel columnar stacking.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The effect of co-precipitation on cadmium(II) adsorption on hydrous aluminium(III) hydroxide in the presence of a range of chelates

The adsorption of cadmium(II) on freshly precipitated aluminium(III) hydroxide in the presence of a range of chelates has been investigated. By precipitating the metal, chelate and adsorbent together it is possible to change the pH variation of the metal-complex adsorption from anionic, ligand-like, binding to cationic binding. This is a general phenomenon and is explained by the formation of a ternary Al-O-Cd-L surface species. As a consequence of the preparation method, the pH edge is found to shift to lower pH values in the presence of the chelate which gives rise to an apparent increase in adsorption of Cd2+. This increase is, in general, most pronounced at [chelate] / [metal] > 1. Computer modelling shows that the observed trends result from the competition between Al-O-Cd-L and Al-L for the available aluminium( III) binding sites. The enhanced adsorption in the presence of phenylenediaminetetraacetate is anomalous since it is observed at a [ chelate] / [metal] approximate to 0.1 and cannot be interpreted by the simple competition model.

Pyrrolidinium Ionic Liquid Crystals

N-Alkyl-N-methylpyrrolidinium cations have been used for the design of ionic liquid crystals, including a new type of uranium-containing metallomesogen. Pyrrolidinium salts with bromide, bis(trifluoromethylsulfonyl)-imide, tetrafluoroborate, hexafluorophosphate, thiocyanate, tetrakis(2-thenoyltrifluoroacetonato)europate(III) and tetrabromouranyl] counteranions were prepared. For the bromide salts and tetrabromouranyl compounds, the chain length of the alkyl group CnH2n+1 was varied from eight to twenty carbon atoms (n =8. 10-20). The compounds show rich mesomorphic behaviour: highly ordered smectic phases (the crystal smectic E phase and the uncommon crystal smectic T phase), smectic A phases, and hexagonal. columnar phases were observed, depending on chain length and anion. This work gives better insight into the nature and formation of the crystal smectic T phase, and the Molecular requirements for the appearance of this highly ordered phase. This uncommon tetragonal mesophase is thoroughly discussed on the basis of detailed powder X-ray diffraction experiments and in relation to the existing literature. Structural models are proposed for self-assembly of the molecules within the smectic layers. In addition, the photophysical properties of the compounds containing a metal complex anion were investigated. For the uranium-containing mesogens, luminescence can be induced by dissolving them in an ionic: liquid matrix. The europium-containing compound shows intense red photoluminescence with high colour Purity.

Imitating micelles as a way to control coordination self-assembly: cage-polymer switching directed rationally by solvent polarity or pH

Disguising a metal complex as a micelle by using amphiphilic phosphine ligands enables it to switch between a coordination polymer and a discrete cage in response to solvent polarity or pH; this medium-dependent behaviour of the complex is rational because it parallels that of true micelles.

Mechanism of Ultrasound Scission of a Silver-Carbene Coordination Polymer

Scission of a supramolecular polymer-metal complex can be carried out using collapsing cavitation bubbles created by ultrasound. Although the most plausible scission mechanism of the coordinative bonds is through mechanical force, the influence of radicals and high hot-spot temperatures on scission has to be considered. A silver(I)-N-heterocyclic carbene complex was exposed to 20 kHz ultrasound in argon, nitrogen, methane, and isobutane saturated toluene. Scission percentages were almost equal under argon, nitrogen, and methane. Radical production differs by a factor of 10 under these gases, indicating that radical production is not a significant contributor to the scission process. A model to describe the displacement of the bubble wall, strain rates, and temperature in the gas shows that critical strain rates for coil-to-stretch transition, needed for scission, are achieved at reactor temperatures of 298 K, an acoustic pressure of 1.2 x 10(5) Pa, and an acoustic frequency of 20 kHz. Lower scission percentages were measured under isobutane, which also shows lower strain rates in model simulations. The activation of the polymer-metal complexes in toluene under the influence of ultrasound occurs through mechanical force.

CO oxidation and NO reduction on metal surfaces: density functional theory investigations

This article reviews the accumulated theoretical results, in particular density functional theory calculations, on two catalytic processes, CO oxidation and NO reduction on metal surfaces. Owing to their importance in automotive emission control, these two reactions have generated a lot of interest in the last 20 years. Here the pathways and energetics of the involved elementary reactions under different catalytic conditions are described in detail and the understanding of the reactions is generalized. It is concluded that density functional theory calculations can be applied to catalysis to elucidate mechanisms of complex surface reactions and to understand the electronic structure of chemical processes in general. The achieved molecular knowledge of chemical reactions is certainly beneficial to new catalyst design.

Steam reforming of model compounds and fast pyrolysis bio-oil on supported noble metal catalysts

The production of hydrogen by steam reforming of bio-oils obtained from the fast pyrolysis of biomass requires the development of efficient catalysts able to cope with the complex chemical nature of the reactant. The present work focuses on the use of noble metal-based catalysts for the steam reforming of a few model compounds and that of an actual bio-oil. The steam reforming of the model compounds was investigated in the temperature range 650-950 degrees C over Pt, Pd and Rh supported on alumina and a ceria-zirconia sample. The model compounds used were acetic acid, phenol, acetone and ethanol. The nature of the support appeared to play a significant role in the activity of these catalysts. The use of ceria-zirconia, a redox mixed oxide, lead to higher H-2 yields as compared to the case of the alumina-supported catalysts. The supported Rh and Pt catalysts were the most active for the steam reforming of these compounds, while Pd-based catalysts poorly performed. The activity of the promising Pt and Rh catalysts was also investigated for the steam reforming of a bio-oil obtained from beech wood fast pyrolysis. Temperatures close to, or higher than, 800 degrees C were required to achieve significant conversions to COx and H-2 (e.g., H-2 yields around 70%). The ceria-zirconia materials showed a higher activity than the corresponding alumina samples. A Pt/ceria-zirconia sample used for over 9 h showed essentially constant activity, while extensive carbonaceous deposits were observed on the quartz reactor walls from early time on stream. In the present case, no benefit was observed by adding a small amount of O-2 to the steam/bio-oil feed (autothermal reforming, ATR), probably partly due to the already high concentration of oxygen in the bio-oil composition. (c) 2005 Elsevier B.V. All rights reserved.

Enantiomeric programming in tripodal transition metal scaffolds

A new route to the isolation of the enantiopure tris- chelate complex (Delta/Lambda)- fac-[Ru( L-1)(3)] 21 (where L-1 is 2,2'-bipyridine-5-carboxylic acid) is demonstrated, where the transition metal centre retains the memory of the chirality present in a simple tripodal tether used to control the metal centred geometry.