Self-assembled triple helicates with preferential helicity

The enantiomerically pure ligands LRR and LSS (N,N'-bis(-2,2'-bipyridyl-5-yl)carbonyl-(1S/R,2S/R)-(+/-)-1,2-diaminocyclohexane) have been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diaminocyclohexane respectively. The crystal structure confirmed that the ligand had a twisted orientation between the two chelating units. The reaction of LRR and LSS with Fe(II), Co(III), Cd(II) and Zn(II) afforded dinuclear complexes confirmed by ES mass spectroscopy. CD spectroscopy indicated that the chiral diaminocyclohexane conferred helicity to the metal centre giving a dominant triple helicate diastereoisomer, with the LRR ligand giving a delta-configuration of each metal centre (P helicate) and the LSS ligand a lambda configuration (M helicate). 1H NMR spectroscopy confirmed a dominant major diastereoisomer with cadmium. The Zn(II) and Cd(II) complexes however were observed to undergo rapid ligand dissociation in solution.

The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Characterisation of a beta-tubulin gene from the liver fluke, Fasciola hepatica.

This study represents the first ß-tubulin sequence from a trematode parasite, namely, the liver fluke, Fasciola hepatica. PCR of genomic DNA showed that at least one ß-tubulin gene from F. hepatica contains no introns. A number of amino acids in the primary sequence of fluke tubulin are different from those described previously in various nematode species and the cestode, Echinococcus multilocularis. ß-Tubulin is an important target for benzimidazole anthelmintics, although (with the exception of triclabendazole) they show limited activity against F. hepatica. The amino acid differences in fluke ß-tubulin are discussed in relation to the selective toxicity of benzimidazoles against helminths and the mechanism of drug resistance.

Tandem enzyme-catalysed oxidations of alkyl phenyl sulfides and alkyl benzenes: enantiocomplementary routes to chiral phenols.

Dioxygenase-catalysed trioxygenation of alkyl phenyl sulfides and alkyl benzenes yields enantiopure cis-dihydrodiol sulfoxides and triols respectively; naphthalene cis-dihydrodiol dehydrogenase-catalysed aromatisation of these diastereoisomers gives enantiopure catechols of either configuration.

Effects of diphosphine structure on aurophilicity and luminescence in Au(I) complexes

The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Biotransformation of Substituted Pyridines with Dioxygenase-containing Microorganisms.

A series of 2-, 3- and 4-substituted pyridines was metabolised using the mutant soil bacterium Pseudomonas putida UV4 which contains a toluene dioxygenase (TDO) enzyme. The regioselectivity of the biotransformation in each case was determined by the position of the substituent. 4-Alkylpyridines were hydroxylated exclusively on the ring to give the corresponding 4-substituted 3-hydroxypyridines, while 3-alkylpyridines were hydroxylated stereoselectively on C-1 of the alkyl group with no evidence of ring hydroxylation. 2-Alkylpyridines gave both ring and side-chain hydroxylation products. Choro- and bromo-substituted pyridines, and pyridine itself, while being poor substrates for P. putida UV4, were converted to some extent to the corresponding 3-hydroxypyridines. These unoptimised biotransformations are rare examples of the direct enzyme-catalysed oxidation of pyridine rings and provide a novel synthetic method for the preparation of substituted pyridinols. Evidence for the involvement of the same TDO enzyme in both ring and side-chain hydroxylation pathways was obtained using a recombinant strain of Escherichia coli (pKST11) containing a cloned gene for TDO. The observed stereoselectivity of the side-chain hydroxylation process in P. putida UV4 was complicated by the action of an alcohol dehydrogenase enzyme in the organism which slowly leads to epimerisation of the initial (R)-alcohol bioproducts by dehydrogenation to the corresponding ketones followed by stereoselective reduction to the (S)-alcohols.

Dioxygenase-catalysed Oxidation of Disubstituted Benzene Substrates: Benzylic Monohydroxylation versus Aryl cis-Dihydroxylation and the Meta Effect

Biotransformations of a series of ortho-, meta- and para-substituted ethylbenzene and propylbenzene substrates have been carried out, using Pseudomonas putida UV4, a source of toluene dioxygenase (TDO). The ortho- and para-substituted alkylbenzene substrates yielded, exclusively, the corresponding enantiopure cis-dihydrodiols of the same absolute configuration. However, the meta isomers, generally, gave benzylic alcohol bioproducts, in addition to the cis-dihydrodiols (the meta effect). The benzylic alcohols were of identical (R) absolute configuration but enantiomeric excess values were variable. The similar (2R) absolute configurations of the cis-dihydrodiols are consistent with both the ethyl and propyl groups having dominant stereodirecting effects over the other substituents. The model used earlier, to predict the regio- and stereo-chemistry of cis-dihydrodiol bioproducts derived from substituted benzene substrates has been refined, to take account of non-symmetric subsituents like ethyl or propyl groups. The formation of benzylic hydroxylation products, from meta-substituted benzene substrates, without further cis-dihydroxylation to yield triols provides a further example of the meta effect during toluene dioxygenase-catalysed oxidations.

Cathepsin L1, the major protease involved in liver fluke (Fasciola hepatica) virulence.

The secretion and activation of the major cathepsin L1 cysteine protease involved in the virulence of the helminth pathogen Fasciola hepatica was investigated. Only the fully processed and active mature enzyme can be detected in medium in which adult F. hepatica are cultured. However, immunocytochemical studies revealed that the inactive procathepsin L1 is packaged in secretory vesicles of epithelial cells that line the parasite gut. These observations suggest that processing and activation of procathepsin L1 occurs following secretion from these cells into the acidic gut lumen. Expression of the 37-kDa procathepsin L1 in Pichia pastoris showed that an intermolecular processing event within a conserved GXNXFXD motif in the propeptide generates an active 30-kDa intermediate form. Further activation of the enzyme was initiated by decreasing the pH to 5.0 and involved the progressive processing of the 37 and 30-kDa forms to other intermediates and finally to a fully mature 24.5 kDa cathepsin L with an additional 1 or 2 amino acids. An active site mutant procathepsin L, constructed by replacing the Cys26 with Gly26, failed to autoprocess. However, [Gly26]procathepsin L was processed by exogenous wild-type cathepsin L to a mature enzyme plus 10 amino acids attached to the N terminus. This exogenous processing occurred without the formation of a 30-kDa intermediate form. The results indicate that activation of procathepsin L1 by removal of the propeptide can occur by different pathways, and that this takes place within the parasite gut where the protease functions in food digestion and from where it is liberated as an active enzyme for additional extracorporeal roles.

Fasciola hepatica cathepsin L-like proteases: biology, function and potential in the development of first generation liver fluke vaccines.

Fasciola hepatica secretes cathepsin L proteases that facilitate the penetration of the parasite through the tissues of its host, and also participate in functions such as feeding and immune evasion. The major proteases, cathepsin L1 (FheCL1) and cathepsin L2 (FheCL2) are members of a lineage that gave rise to the human cathepsin Ls, Ks and Ss, but while they exhibit similarities in their substrate specificities to these enzymes they differ in having a wider pH range for activity and an enhanced stability at neutral pH. There are presently 13 Fasciola cathepsin L cDNAs deposited in the public databases representing a gene family of at least seven distinct members, although the temporal and spatial expression of each of these members in the developmental stage of F. hepatica remains unclear. Immunolocalisation and in situ hybridisation studies, using antibody and DNA probes, respectively, show that the vast majority of cathepsin L gene expression is carried out in the epithelial cells lining the parasite gut. Within these cells the enzyme is packaged into secretory vesicles that release their contents into the gut lumen for the purpose of degrading ingested host tissue and blood. Liver flukes also express a novel multi-domain cystatin that may be involved in the regulation of cathepsin L activity. Vaccine trials in both sheep and cattle with purified native FheCL1 and FheCL2 have shown that these enzymes can induce protection, ranging from 33 to 79%, to experimental challenge with metacercariae of F. hepatica, and very potent anti-embryonation/hatch rate effects that would block parasite transmission. In this article we review the vaccine trials carried out over the past 8 years, the role of antibody and T cell responses in mediating protection and discuss the prospects of the cathepsin Ls in the development of first generation recombinant liver fluke vaccines. Author Keywords: Helminths; Trematodes; Parasites; Cathepsins; Proteases; Vaccines; Immunology; Biochemistry