308 resultados para Simple Sequence Repeats


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A simple method for preparing bulk quantities of tRNA from chick embryo has been developed. In this method chick embryos were homogenized in a buffer of pH 4.5, followed by deproteinization with phenol. The aqueous layer was allowed to separate under gravity. The resulting aqueous layer, after two more phenol treatments, was directly passed through a DEAE-cellulose column and the tRNA eluted therefrom with 1 Image NaCl. The tRNA prepared by this method was as active as the one prepared at neutral pH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The special class of quasi-simple wave solutions is studied for the system of partial differential equations governing inviscid acoustic gravity waves. It is shown that these traveling wave solutions do not admit shocks. Periodic solutions are found to exist when there is no propagation in the vertical direction. The solutions for some particular cases are depicted graphically. Physics of Fluids is copyrighted by The American Institute of Physics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low-voltage and high-current switching delay characteristics of a simple triggered vacuum gap (TVG) are described using lead zirconate titanate as the dielectric material in the auxiliary gap. This TVG has superior performance at high currents (up to 14 kA was studied) with regard to delay, reliable firing and extended life as compared to the one using either supramica or silicon carbide. The total delay consists of three intervals: to break down the auxiliary gap, to propagate the trigger plasma and to break down the main gap. The data on the influence of the various parameters like the trigger voltage, current, energy and the main circuit energy are given. It has been found that the delay due to the first two intervals is small compared to the third.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Relative band strengths of diatomic molecules for which the product of Franck-Condon factor and r-centroid is approximately equal to 1 for (0,0) band can be determined by a simple method which will be in good agreement with the smoothed array of experimental values.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Genome sequence information has generated increasing evidence for the claim that repetitive DNA sequences present within and around genes could play a important role in the regulation of gene expression. Polypurine/polypyrimidine sequences [poly(Pu/Py)] have been observed in the vicinity of promoters and within the transcribed regions of many genes. To understand whether such sequences influence the level of gene expression, we constructed several prokaryotic and eukaryotic expression vectors incorporating poly(Pu/Py) repeats both within and upstream of a reporter gene, lacZ (encoding β-galactosidase), and studied its expression in vivo. We find that, in contrast to the situation in Escherichia coli, the presence of poly(Pu/Py) sequences within the gene does not significantly inhibit gene expression in mammalian cells. On the other hand, the presence of such sequences upstream of lacZ leads to a several-fold reduction of gene expression in mammalian cells. Similar down-regulation was observed when a structural cassette containing poly(Pu/Py) sequences upstream of lacZ was integrated into yeast chromosome V. Sequence analysis of the nine totally sequenced yeast chromosomes shows that a large number of such sequences occur upstream of ORFs. On the basis of our experimental results and DNA sequence analysis, we propose that these sequences can function as cis-acting transcriptional regulators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The complete genome of the baker's yeast S. cerevisiae was analyzed for the presence of polypurine/polypyrimidine (poly[pu/py]) repeats and their occurrences were classified on the basis of their location within and outside open reading frames (ORFs). The analysis reveals that such sequence motifs are present abundantly both in coding as well as noncoding regions. Clear positional preferences are seen when these tracts occur in noncoding regions. These motifs appear to occur predominantly at a unit nucleosomal length both upstream and downstream of ORFs. Moreover, there is a biased distribution of polypurines in the coding strands when these motifs occur within open reading frames. The significance of the biased distribution is discussed with reference to the occurrence of these motifs in other known mRNA sequences and expressed sequence tags. A model for cis regulation of gene expression is proposed based on the ability of these motifs to form an intermolecular triple helix structure when present within the coding region and/or to modulate nucleosome positioning via enhanced histone affinity when present outside coding regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.