A Convenient Route for the Synthesis of Complex Metal Oxides Employing Solid-Solution Precursors

Synthesis of complex metal oxides by the thermal decomposition of solid-solution precursors (formed by isomorphous compounds of component metals) has been investigated since the method enables mixing of cations on an atomic scale and drastically reduces diffusion distances to a few angstroms. Several interesting oxides such as Ca2Fe03,5C, aCoz04,C a2C0205a, nd Ca,FeCo05 have been prepared by this technique starting from carbonate solid solutions of the type Ca,-,Fe,C03, Cal-,Co,C03, and Ca,-,,M,M'yC03 (M, M' = Mn, Fe, Co). The method has been extended to oxalate solid-solution precursors, and the possibility of making use of other kinds of precursor solid solutions is indicated.

Sequence effects in structures of the dinucleotides d-pApT AND d-pTpA

The H1',H2' and H2″ regions of the 270-MHz PMR spectra of two deoxydinucleotides, d-pTpA and d-pApT, have been analyzed. The coupling constants in the sugar ring indicate that both A and T sugars have a tendency to acquire 2E conformations. There is also a marginal difference in the 2E populations of the T sugar in the two dinucleotides. The trends in the chemical shifts of base protons indicate different stacking of the bases in d-pApT and d-pTpA. The sequence effects on base stacking and pentose conformation are discussed.

The conformation of (μ-butatriene)hexacarbonyldiiron complex from proton NMR studies in three nematic phases

Proton NMR spectroscopy in three different liquid crystals has been used to determine two conformational angles of (μ-butatriene)hexacarbonyldiiron complex, namely the angle between the two CH2 planes and the dihedral angle between the two planes containing four carbon atoms of the butatriene moiety. The values are 44 and 46°, respectively. The direct and the indirect geminal HH couplings are shown to be of the same sign in the liquid crystals with positive diamagnetic anisotropy.

Sequence-dependent molecular conformation of polynucleotides: right and left-handed helices

Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.

Modified design procedure for a sparger reactor sequence

In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

A Generalized Approach to Multiresolution Complex SAR Signal Processing

Multiresolution synthetic aperture radar (SAR) image formation has been proven to be beneficial in a variety of applications such as improved imaging and target detection as well as speckle reduction. SAR signal processing traditionally carried out in the Fourier domain has inherent limitations in the context of image formation at hierarchical scales. We present a generalized approach to the formation of multiresolution SAR images using biorthogonal shift-invariant discrete wavelet transform (SIDWT) in both range and azimuth directions. Particularly in azimuth, the inherent subband decomposition property of wavelet packet transform is introduced to produce multiscale complex matched filtering without involving any approximations. This generalized approach also includes the formulation of multilook processing within the discrete wavelet transform (DWT) paradigm. The efficiency of the algorithm in parallel form of execution to generate hierarchical scale SAR images is shown. Analytical results and sample imagery of diffuse backscatter are presented to validate the method.

Structural studies of analgesics and their interactions. Part 4. Crystal structures of phenylbutazone and a 2 : 1 complex between phenylbutazone and piperazine

The X-ray crystal structures of 4-butyl-1,2-diphenylpyrazolidine-3,5-dione (phenylbutazone)(I). and its 2 : 1 complex (II) with piperazine have been determined by direct methods and the structures refined to R 0.096 (2 300 observed reflections measured by diffractometer) and 0.074 (2 494 observed reflections visuallyestimated). Crystals are monoclinic, space group P21/c; for (I)a= 21.695(4), b= 5.823(2), c= 27.881(4)Å, = 108.06 (10)°, Z= 8, and for (II)a= 8.048(4), b= 15.081(4), c= 15.583(7)Å, = 95.9(3)°, Z= 2. The two crystallographically independant molecules in the structure of (I) are similar except for the conformation of the butyl group, which is disordered in one of the molecules. In the pyrazolidinedione group, the two C–C bonds are single and the two C–O bonds double. The two nitrogen atoms in the five-membered ring are pyramidal with the attached phenyl groups lying on the opposite sides of the mean plane of the ring. The phenylbutazone molecule in (II) exists as a negative ion owing to deprotonation of C-4. C-4 is therefore trigonal and the orientation of the Bu group with respect to the pyrazolidinedione group is considerably different from that in (I); there is also considerable electron delocalization along the C–O and C–C bonds. These changes in geometry and electronic structure may relate to biological activity. The doubly charged cationic piperazine molecule exists in the chair form with the nitrogen atoms at the apices. The crystal structure of (II) is stabilized by ionic interactions and N–H O hydrogen bonds.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

X-ray crystal structure of a ternary copper(II) vitamin B6 complex, hydroxo(2,2'-bipyridyl)(pyridoxinato) copper(II) monohydrate. A rare example of monodentate coordination of copper(II) by the hydroxyl ion

A ternary metal complex involving Vitamin B6 with the formula [Cu(bipy)(pn) (OH)]H2O (bipy = 2,2'²-bipyridine, PN = anionic pyridoxine) has been synthesized and studied in the solid state by means of spectroscopy and X-ray crystallography. The geometry around copper(II) is distorted square pyramidal, two oxygens from phenolic and 4-(hydroxymethyl) groups of pn, two nitrogens from bipy and an axial OH- ion forming the coordination sphere. In this structure pn exists in a new anionic form with deprotonation of the phenolic group. The structure also provides a rare example of monodentate hydroxyl coordination to copper.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.