Critical behaviour of electrical resistivity in 5 binary liquid systems

For five binary liquid systems CS2+CH3CN, CS2+CH3NO2, CS2+(CH3CO)2O, C6H12+(CH3CO)2O, n-C7H16+(CH3CO)2O, the electrical resistance has been measured near the critical solution temperatures. The behaviour is universal. Below Tc, the conductivities of the two phases follow σ1−σ2 β, where = T−Tc Tc with β≈0.35. In the one phase region with b≈0.35±0.1 and is positive in some cases and negative in others.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Critical Exponent β and Rectilinear Diameter of the Binary-Liquid System Carbon Disulfide + Nitromethane

The system CS2 + CH3NO2 shows β=0.315±0.004 over 10-6<ε=|T-Tc| / Tc<2-10-1 with no indication of a classical value ½ even far away from Tc. The diameter shows a curvature and is of the form - c+b ε+fε7 / 8exp(-gεh).

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Embryogenesis in flowering plants: Recent approaches and prospects

The overall architectural pattern of the mature plant is established during embryogenesis. Very little is known about the molecular processes that underlie embryo morphogenesis. Last decade has, nevertheless, seen a burst of information on the subject. The synchronous somatic embryogenesis system of carrot is largely being used as the experimental system. Information on the molecular regulation of embryogenesis obtained with carrot somatic embryos as well as observations on sandalwood embryogenic system developed in our laboratory are summarized in this review. The basic experimental strategy of molecular analysis mostly relied on a comparison between genes and proteins being expressed in embryogenic and non-embryogenic cells as well as in the different stages of embryogenesis. Events such as expression of totipotency of cells and establishment of polarity which are so critical for embryo development have been characterized using the strategy, Several genes have been identified and cloned from the carrot system, These include sequences that encode certain extracellular proteins (EPs) that influence cell proliferation and embryogenesis in specific ways and sequences of the abscisic acid (ABA) inducible late embryogenesis abundant (LEA) proteins which are most abundant and differentially expressed mRNAs in somatic embryos. That LEAs are expressed in the somatic embryos of a tree flora also is evidenced from studies on sandalwood Several undescribed or novel sequences that are enhanced in embryos were identified. A sequence of this nature exists in sandalwood embryos was demonstrated using a Cuscuta haustorial (organ-specific) cDNA probe. Somatic embryogenesis systems have been used to assess the expression of genes isolated from non-embryogenic tissues. Particular attention has been focused on both cell cycle and histone genes.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Chemistry and biology of DNA methyltransferases

Recognition of a specific DNA sequence by a protein is probably the best example of macromolecular interactions leading to various events. It is a prerequisite to understanding the basis of protein-DNA interactions to obtain a better insight into fundamental processes such as transcription, replication, repair, and recombination. DNA methyltransferases with varying sequence specificities provide an excellent model system for understanding the molecular mechanism of specific DNA recognition. Sequence comparison of cloned genes, along with mutational analyses and recent crystallographic studies, have clearly defined the functions of various conserved motifs. These enzymes access their target base in an elegant manner by flipping it out of the DNA double helix. The drastic protein-induced DNA distortion, first reported for HhaI DNA methyltransferase, appears to be a common mechanism employed by various proteins that need to act on bases. A remarkable feature of the catalytic mechanism of DNA (cytosine-5) methyltransferases is the ability of these enzymes to induce deamination of the target cytosine in the absence of S-adenosyl-L-methionine or its analogs. The enzyme-catalyzed deamination reaction is postulated to be the major cause of mutational hotspots at CpG islands responsible for various human genetic disorders. Methylation of adenine residues in Escherichia coli is known to regulate various processes such as transcription, replication, repair, recombination, transposition, and phage packaging.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Liquid-liquid critical phenomena. The coexistence curve of n-heptane-acetic anhydride

The coexistence curve of the binary liquid mixture n-heptane-acetic anhydride has been determined by the observation of the transition temperatures of 76 samples over the range of compositions. The functional form of the difference in order parameter, in terms of either the mole fraction or the volume fraction, is consistent with theoretical predictions invoking the concept of universality at critical points. The average value of the order parameter, the diameter of the coexistence curve, shows an anomaly which can be described by either an exponent 1 - a, as predicted by various theories (where a is the critical exponent of the specific heat), or by an exponent 20 (where P is the coexistence curve exponent), as expected when the order parameter used is not the one the diameter of which diverges asymptotically as 1 - a.

Sequence Specific Interaction between Promoter DNA and Escherichia coli RNA Polymerase: Comparative Thermodynamic Analysis with One Immobilized Partner

Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.

Negative sequence compensation within fundamental positive sequence reference frame for a stiff micro-grid generation in a wind power system using slip ring induction machine

An isolated wind power generation scheme using slip ring induction machine (SRIM) is proposed. The proposed scheme maintains constant load voltage and frequency irrespective of the wind speed or load variation. The power circuit consists of two back-to-back connected inverters with a common dc link, where one inverter is directly connected to the rotor side of SRIM and the other inverter is connected to the stator side of the SRIM through LC filter. Developing a negative sequence compensation method to ensure that, even under the presence of unbalanced load, the generator experiences almost balanced three-phase current and most of the unbalanced current is directed through the stator side converter is the focus here. The SRIM controller varies the speed of the generator with variation in the wind speed to extract maximum power. The difference of the generated power and the load power is either stored in or extracted from a battery bank, which is interfaced to the common dc link through a multiphase bidirectional fly-back dc-dc converter. The SRIM control scheme, maximum power point extraction algorithm and the fly-back converter topology are incorporated from available literature. The proposed scheme is both simulated and experimentally verified.