149 resultados para Sequence controllers, Programmable.
Resumo:
In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.
Resumo:
The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.
Resumo:
The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%
Resumo:
Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.
Resumo:
Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.
Resumo:
VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.
Resumo:
Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.
Resumo:
An isolated wind power generation scheme using slip ring induction machine (SRIM) is proposed. The proposed scheme maintains constant load voltage and frequency irrespective of the wind speed or load variation. The power circuit consists of two back-to-back connected inverters with a common dc link, where one inverter is directly connected to the rotor side of SRIM and the other inverter is connected to the stator side of the SRIM through LC filter. Developing a negative sequence compensation method to ensure that, even under the presence of unbalanced load, the generator experiences almost balanced three-phase current and most of the unbalanced current is directed through the stator side converter is the focus here. The SRIM controller varies the speed of the generator with variation in the wind speed to extract maximum power. The difference of the generated power and the load power is either stored in or extracted from a battery bank, which is interfaced to the common dc link through a multiphase bidirectional fly-back dc-dc converter. The SRIM control scheme, maximum power point extraction algorithm and the fly-back converter topology are incorporated from available literature. The proposed scheme is both simulated and experimentally verified.
Resumo:
In recent years, identification of sequence patterns has been given immense importance to understand better their significance with respect to genomic organization and evolutionary processes. To this end, an algorithm has been derived to identify all similar sequence repeats present in a protein sequence. The proposed algorithm is useful to correlate the three-dimensional structure of various similar sequence repeats available in the Protein Data Bank against the same sequence repeats present in other databases like SWISS-PROT, PIR and Genome databases.
Pi-turns in proteins and peptides: Classification, conformation, occurrence, hydration and sequence.
Resumo:
The i + 5-->i hydrogen bonded turn conformation (pi-turn) with the fifth residue adopting alpha L conformation is frequently found at the C-terminus of helices in proteins and hence is speculated to be a "helix termination signal." An analysis of the occurrence of i + 5-->i hydrogen bonded turn conformation at any general position in proteins (not specifically at the helix C-terminus), using coordinates of 228 protein crystal structures determined by X-ray crystallography to better than 2.5 A resolution is reported in this paper. Of 486 detected pi-turn conformations, 367 have the (i + 4)th residue in alpha L conformation, generally occurring at the C-terminus of alpha-helices, consistent with previous observations. However, a significant number (111) of pi-turn conformations occur with (i + 4)th residue in alpha R conformation also, generally occurring in alpha-helices as distortions either at the terminii or at the middle, a novel finding. These two sets of pi-turn conformations are referred to by the names pi alpha L and pi alpha R-turns, respectively, depending upon whether the (i + 4)th residue adopts alpha L or alpha R conformations. Four pi-turns, named pi alpha L'-turns, were noticed to be mirror images of pi alpha L-turns, and four more pi-turns, which have the (i + 4)th residue in beta conformation and denoted as pi beta-turns, occur as a part of hairpin bend connecting twisted beta-strands. Consecutive pi-turns occur, but only with pi alpha R-turns. The preference for amino acid residues is different in pi alpha L and pi alpha R-turns. However, both show a preference for Pro after the C-termini. Hydrophilic residues are preferred at positions i + 1, i + 2, and i + 3 of pi alpha L-turns, whereas positions i and i + 5 prefer hydrophobic residues. Residue i + 4 in pi alpha L-turns is mainly Gly and less often Asn. Although pi alpha R-turns generally occur as distortions in helices, their amino acid preference is different from that of helices. Poor helix formers, such as His, Tyr, and Asn, also were found to be preferred for pi alpha R-turns, whereas good helix former Ala is not preferred. pi-Turns in peptides provide a picture of the pi-turn at atomic resolution. Only nine peptide-based pi-turns are reported so far, and all of them belong to pi alpha L-turn type with an achiral residue in position i + 4. The results are of importance for structure prediction, modeling, and de novo design of proteins.
Resumo:
The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.
Resumo:
Software packages NUPARM and NUCGEN, are described, which can be used to understand sequence directed structural variations in nucleic acids, by analysis and generation of non-uniform structures. A set of local inter basepair parameters (viz. tilt, roll, twist, shift, slide and rise) have been defined, which use geometry and coordinates of two successive basepairs only and can be used to generate polymeric structures with varying geometries for each of the 16 possible dinucleotide steps. Intra basepair parameters, propeller, buckle, opening and the C6...C8 distance can also be varied, if required, while the sugar phosphate backbone atoms are fixed in some standard conformation ill each of the nucleotides. NUPARM can be used to analyse both DNA and RNA structures, with single as well as double stranded helices. The NUCGEN software generates double helical models with the backbone fixed in B-form DNA, but with appropriate modifications in the input data, it can also generate A-form DNA ar rd RNA duplex structures.