166 resultados para Sequence Motifs
Resumo:
Spectroscopic studies on pd(CG)3 and pd(GC)3 have been carried out to elucidate the sequence dependence and effect of free 5'-phosphate on the B to Z transition. Unlike d(CG)3, pd(CG)3 fails to undergo salt-induced B to Z transition at ambient temperature. Model building studies have been carried out to determine the inhibitory role of the 5'-phosphate group, but have been unsuccessful.
Resumo:
A simple instrument that can provide a sequence of timed pulses for first initiating a transient process and then enabling sampling and recording periodically during the course of the transient event is described. The time delay between the first of these sampling pulses and the start of the transient event is adjustable. This sequence generator has additional features that make it ideal for use in acquiring the waveforms when a storage oscilloscope is used as the recording device. For avoiding the clutter caused by many waveforms being recorded at the same place on an oscilloscope screen such features as displacements of waveforms in the X and Y directions and trace blanking at places where the waveform is not required, have been incorporated. This sequence generator has been employed to acquire a sequence of Raman scattered radiation signals from an adiabatically expanding saturated vapour probed by a flashlamp-pumped dye laser.
Resumo:
Abstract is not available.
Resumo:
The H1',H2' and H2″ regions of the 270-MHz PMR spectra of two deoxydinucleotides, d-pTpA and d-pApT, have been analyzed. The coupling constants in the sugar ring indicate that both A and T sugars have a tendency to acquire 2E conformations. There is also a marginal difference in the 2E populations of the T sugar in the two dinucleotides. The trends in the chemical shifts of base protons indicate different stacking of the bases in d-pApT and d-pTpA. The sequence effects on base stacking and pentose conformation are discussed.
Resumo:
Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.
Resumo:
In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.
Resumo:
The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.
Resumo:
The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%
Resumo:
Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.
Resumo:
Human CGI-58 (for comparative gene identification-58) and YLR099c, encoding Ict1p in Saccharomyces cerevisiae, have recently been identified as acyl-CoA-dependent lysophosphatidic acid acyltransferases. Sequence database searches for CGI-58 like proteins in Arabidopsis (Arabidopsis thaliana) revealed 24 proteins with At4g24160, a member of the alpha/beta-hydrolase family of proteins being the closest homolog. At4g24160 contains three motifs that are conserved across the plant species: a GXSXG lipase motif, a HX4D acyltransferase motif, and V(X)(3)HGF, a probable lipid binding motif. Dendrogram analysis of yeast ICT1, CGI-58, and At4g24160 placed these three polypeptides in the same group. Here, we describe and characterize At4g24160 as, to our knowledge, the first soluble lysophosphatidic acid acyltransferase in plants. A lipidomics approach revealed that At4g24160 has additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. These data establish At4g24160, a protein with a previously unknown function, as an enzyme that might play a pivotal role in maintaining the lipid homeostasis in plants by regulating both phospholipid and neutral lipid levels.
Resumo:
Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.
Resumo:
Recognition of a specific DNA sequence by a protein is probably the best example of macromolecular interactions leading to various events. It is a prerequisite to understanding the basis of protein-DNA interactions to obtain a better insight into fundamental processes such as transcription, replication, repair, and recombination. DNA methyltransferases with varying sequence specificities provide an excellent model system for understanding the molecular mechanism of specific DNA recognition. Sequence comparison of cloned genes, along with mutational analyses and recent crystallographic studies, have clearly defined the functions of various conserved motifs. These enzymes access their target base in an elegant manner by flipping it out of the DNA double helix. The drastic protein-induced DNA distortion, first reported for HhaI DNA methyltransferase, appears to be a common mechanism employed by various proteins that need to act on bases. A remarkable feature of the catalytic mechanism of DNA (cytosine-5) methyltransferases is the ability of these enzymes to induce deamination of the target cytosine in the absence of S-adenosyl-L-methionine or its analogs. The enzyme-catalyzed deamination reaction is postulated to be the major cause of mutational hotspots at CpG islands responsible for various human genetic disorders. Methylation of adenine residues in Escherichia coli is known to regulate various processes such as transcription, replication, repair, recombination, transposition, and phage packaging.